ID: 1114830450

View in Genome Browser
Species Human (GRCh38)
Location 14:26135159-26135181
Sequence TCCAGGTCCCTAGAGATGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114830450_1114830457 11 Left 1114830450 14:26135159-26135181 CCCTACATCTCTAGGGACCTGGA No data
Right 1114830457 14:26135193-26135215 CTGTTGTCACAGAATCCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114830450 Original CRISPR TCCAGGTCCCTAGAGATGTA GGG (reversed) Intergenic
No off target data available for this crispr