ID: 1114830457

View in Genome Browser
Species Human (GRCh38)
Location 14:26135193-26135215
Sequence CTGTTGTCACAGAATCCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114830450_1114830457 11 Left 1114830450 14:26135159-26135181 CCCTACATCTCTAGGGACCTGGA No data
Right 1114830457 14:26135193-26135215 CTGTTGTCACAGAATCCATGTGG No data
1114830456_1114830457 -6 Left 1114830456 14:26135176-26135198 CCTGGAGAGGAGGGGTTCTGTTG No data
Right 1114830457 14:26135193-26135215 CTGTTGTCACAGAATCCATGTGG No data
1114830451_1114830457 10 Left 1114830451 14:26135160-26135182 CCTACATCTCTAGGGACCTGGAG No data
Right 1114830457 14:26135193-26135215 CTGTTGTCACAGAATCCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114830457 Original CRISPR CTGTTGTCACAGAATCCATG TGG Intergenic
No off target data available for this crispr