ID: 1114835444

View in Genome Browser
Species Human (GRCh38)
Location 14:26198037-26198059
Sequence CAGGAAAAGCAGACATAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114835438_1114835444 19 Left 1114835438 14:26197995-26198017 CCTTTATCATGAAAATGTTGATT No data
Right 1114835444 14:26198037-26198059 CAGGAAAAGCAGACATAGTGAGG No data
1114835442_1114835444 -4 Left 1114835442 14:26198018-26198040 CCTAGGAGAAGGGAAAAAGCAGG No data
Right 1114835444 14:26198037-26198059 CAGGAAAAGCAGACATAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114835444 Original CRISPR CAGGAAAAGCAGACATAGTG AGG Intergenic
No off target data available for this crispr