ID: 1114838510

View in Genome Browser
Species Human (GRCh38)
Location 14:26233623-26233645
Sequence CCTCCTGTAATAATGATAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114838505_1114838510 7 Left 1114838505 14:26233593-26233615 CCCTTTAAAGCACTCCACAGAGA No data
Right 1114838510 14:26233623-26233645 CCTCCTGTAATAATGATAGATGG No data
1114838506_1114838510 6 Left 1114838506 14:26233594-26233616 CCTTTAAAGCACTCCACAGAGAA No data
Right 1114838510 14:26233623-26233645 CCTCCTGTAATAATGATAGATGG No data
1114838507_1114838510 -7 Left 1114838507 14:26233607-26233629 CCACAGAGAATACATCCCTCCTG No data
Right 1114838510 14:26233623-26233645 CCTCCTGTAATAATGATAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114838510 Original CRISPR CCTCCTGTAATAATGATAGA TGG Intergenic
No off target data available for this crispr