ID: 1114841000

View in Genome Browser
Species Human (GRCh38)
Location 14:26261634-26261656
Sequence TAGCTAAGGATATTACAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114841000_1114841005 7 Left 1114841000 14:26261634-26261656 CCTGTCTGTAATATCCTTAGCTA No data
Right 1114841005 14:26261664-26261686 AATGAGTATAGCACTTTAGGGGG No data
1114841000_1114841002 4 Left 1114841000 14:26261634-26261656 CCTGTCTGTAATATCCTTAGCTA No data
Right 1114841002 14:26261661-26261683 CACAATGAGTATAGCACTTTAGG No data
1114841000_1114841004 6 Left 1114841000 14:26261634-26261656 CCTGTCTGTAATATCCTTAGCTA No data
Right 1114841004 14:26261663-26261685 CAATGAGTATAGCACTTTAGGGG No data
1114841000_1114841003 5 Left 1114841000 14:26261634-26261656 CCTGTCTGTAATATCCTTAGCTA No data
Right 1114841003 14:26261662-26261684 ACAATGAGTATAGCACTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114841000 Original CRISPR TAGCTAAGGATATTACAGAC AGG (reversed) Intergenic
No off target data available for this crispr