ID: 1114844712

View in Genome Browser
Species Human (GRCh38)
Location 14:26307630-26307652
Sequence CTGGCTGCCCAGATCTCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114844703_1114844712 27 Left 1114844703 14:26307580-26307602 CCTCAGTCCTAGCACCAGTGTAT No data
Right 1114844712 14:26307630-26307652 CTGGCTGCCCAGATCTCCCTTGG No data
1114844709_1114844712 -4 Left 1114844709 14:26307611-26307633 CCCTTAGCAATCTTGGACACTGG No data
Right 1114844712 14:26307630-26307652 CTGGCTGCCCAGATCTCCCTTGG No data
1114844705_1114844712 13 Left 1114844705 14:26307594-26307616 CCAGTGTATATCACACCCCCTTA No data
Right 1114844712 14:26307630-26307652 CTGGCTGCCCAGATCTCCCTTGG No data
1114844708_1114844712 -3 Left 1114844708 14:26307610-26307632 CCCCTTAGCAATCTTGGACACTG No data
Right 1114844712 14:26307630-26307652 CTGGCTGCCCAGATCTCCCTTGG No data
1114844711_1114844712 -5 Left 1114844711 14:26307612-26307634 CCTTAGCAATCTTGGACACTGGC No data
Right 1114844712 14:26307630-26307652 CTGGCTGCCCAGATCTCCCTTGG No data
1114844707_1114844712 -2 Left 1114844707 14:26307609-26307631 CCCCCTTAGCAATCTTGGACACT No data
Right 1114844712 14:26307630-26307652 CTGGCTGCCCAGATCTCCCTTGG No data
1114844704_1114844712 20 Left 1114844704 14:26307587-26307609 CCTAGCACCAGTGTATATCACAC No data
Right 1114844712 14:26307630-26307652 CTGGCTGCCCAGATCTCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114844712 Original CRISPR CTGGCTGCCCAGATCTCCCT TGG Intergenic
No off target data available for this crispr