ID: 1114846102

View in Genome Browser
Species Human (GRCh38)
Location 14:26324010-26324032
Sequence GACCACCTGGACCCCCGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114846097_1114846102 13 Left 1114846097 14:26323974-26323996 CCAGGAGCATTGGCAGATCCTGT No data
Right 1114846102 14:26324010-26324032 GACCACCTGGACCCCCGAGAAGG No data
1114846094_1114846102 24 Left 1114846094 14:26323963-26323985 CCCATCAATTGCCAGGAGCATTG No data
Right 1114846102 14:26324010-26324032 GACCACCTGGACCCCCGAGAAGG No data
1114846093_1114846102 25 Left 1114846093 14:26323962-26323984 CCCCATCAATTGCCAGGAGCATT No data
Right 1114846102 14:26324010-26324032 GACCACCTGGACCCCCGAGAAGG No data
1114846095_1114846102 23 Left 1114846095 14:26323964-26323986 CCATCAATTGCCAGGAGCATTGG No data
Right 1114846102 14:26324010-26324032 GACCACCTGGACCCCCGAGAAGG No data
1114846099_1114846102 -5 Left 1114846099 14:26323992-26324014 CCTGTTTAACACCAGCAGGACCA No data
Right 1114846102 14:26324010-26324032 GACCACCTGGACCCCCGAGAAGG No data
1114846092_1114846102 28 Left 1114846092 14:26323959-26323981 CCTCCCCATCAATTGCCAGGAGC No data
Right 1114846102 14:26324010-26324032 GACCACCTGGACCCCCGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114846102 Original CRISPR GACCACCTGGACCCCCGAGA AGG Intergenic
No off target data available for this crispr