ID: 1114848893

View in Genome Browser
Species Human (GRCh38)
Location 14:26359057-26359079
Sequence AGAGCCTATCAAGGCAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114848893_1114848896 12 Left 1114848893 14:26359057-26359079 CCAGCTTTGCCTTGATAGGCTCT No data
Right 1114848896 14:26359092-26359114 AAGATAGACAAAGTTTTGTCAGG No data
1114848893_1114848899 26 Left 1114848893 14:26359057-26359079 CCAGCTTTGCCTTGATAGGCTCT No data
Right 1114848899 14:26359106-26359128 TTTGTCAGGGAGTCAAAATTGGG No data
1114848893_1114848898 25 Left 1114848893 14:26359057-26359079 CCAGCTTTGCCTTGATAGGCTCT No data
Right 1114848898 14:26359105-26359127 TTTTGTCAGGGAGTCAAAATTGG No data
1114848893_1114848897 13 Left 1114848893 14:26359057-26359079 CCAGCTTTGCCTTGATAGGCTCT No data
Right 1114848897 14:26359093-26359115 AGATAGACAAAGTTTTGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114848893 Original CRISPR AGAGCCTATCAAGGCAAAGC TGG (reversed) Intergenic
No off target data available for this crispr