ID: 1114849072

View in Genome Browser
Species Human (GRCh38)
Location 14:26360640-26360662
Sequence TGGTGCACAATATTTCTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114849072_1114849076 10 Left 1114849072 14:26360640-26360662 CCCATCAGAAATATTGTGCACCA No data
Right 1114849076 14:26360673-26360695 TTTATCTTTCCATGAAATAAAGG No data
1114849072_1114849077 11 Left 1114849072 14:26360640-26360662 CCCATCAGAAATATTGTGCACCA No data
Right 1114849077 14:26360674-26360696 TTATCTTTCCATGAAATAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114849072 Original CRISPR TGGTGCACAATATTTCTGAT GGG (reversed) Intergenic
No off target data available for this crispr