ID: 1114850196

View in Genome Browser
Species Human (GRCh38)
Location 14:26374169-26374191
Sequence CATTGGCTGGGAGCAACCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114850196_1114850202 -2 Left 1114850196 14:26374169-26374191 CCTTAGGTTGCTCCCAGCCAATG No data
Right 1114850202 14:26374190-26374212 TGAACGTGGCAGGAACACTGAGG No data
1114850196_1114850203 22 Left 1114850196 14:26374169-26374191 CCTTAGGTTGCTCCCAGCCAATG No data
Right 1114850203 14:26374214-26374236 ACGCTGATTCCTGAGAGATGAGG No data
1114850196_1114850204 23 Left 1114850196 14:26374169-26374191 CCTTAGGTTGCTCCCAGCCAATG No data
Right 1114850204 14:26374215-26374237 CGCTGATTCCTGAGAGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114850196 Original CRISPR CATTGGCTGGGAGCAACCTA AGG (reversed) Intergenic