ID: 1114850199

View in Genome Browser
Species Human (GRCh38)
Location 14:26374181-26374203
Sequence TCCTGCCACGTTCATTGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114850199_1114850204 11 Left 1114850199 14:26374181-26374203 CCCAGCCAATGAACGTGGCAGGA No data
Right 1114850204 14:26374215-26374237 CGCTGATTCCTGAGAGATGAGGG No data
1114850199_1114850207 28 Left 1114850199 14:26374181-26374203 CCCAGCCAATGAACGTGGCAGGA No data
Right 1114850207 14:26374232-26374254 TGAGGGATTTCTCTGACAGGTGG No data
1114850199_1114850203 10 Left 1114850199 14:26374181-26374203 CCCAGCCAATGAACGTGGCAGGA No data
Right 1114850203 14:26374214-26374236 ACGCTGATTCCTGAGAGATGAGG No data
1114850199_1114850206 25 Left 1114850199 14:26374181-26374203 CCCAGCCAATGAACGTGGCAGGA No data
Right 1114850206 14:26374229-26374251 AGATGAGGGATTTCTCTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114850199 Original CRISPR TCCTGCCACGTTCATTGGCT GGG (reversed) Intergenic