ID: 1114850201

View in Genome Browser
Species Human (GRCh38)
Location 14:26374186-26374208
Sequence AGTGTTCCTGCCACGTTCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114850201_1114850207 23 Left 1114850201 14:26374186-26374208 CCAATGAACGTGGCAGGAACACT No data
Right 1114850207 14:26374232-26374254 TGAGGGATTTCTCTGACAGGTGG No data
1114850201_1114850206 20 Left 1114850201 14:26374186-26374208 CCAATGAACGTGGCAGGAACACT No data
Right 1114850206 14:26374229-26374251 AGATGAGGGATTTCTCTGACAGG No data
1114850201_1114850203 5 Left 1114850201 14:26374186-26374208 CCAATGAACGTGGCAGGAACACT No data
Right 1114850203 14:26374214-26374236 ACGCTGATTCCTGAGAGATGAGG No data
1114850201_1114850204 6 Left 1114850201 14:26374186-26374208 CCAATGAACGTGGCAGGAACACT No data
Right 1114850204 14:26374215-26374237 CGCTGATTCCTGAGAGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114850201 Original CRISPR AGTGTTCCTGCCACGTTCAT TGG (reversed) Intergenic