ID: 1114850202

View in Genome Browser
Species Human (GRCh38)
Location 14:26374190-26374212
Sequence TGAACGTGGCAGGAACACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114850196_1114850202 -2 Left 1114850196 14:26374169-26374191 CCTTAGGTTGCTCCCAGCCAATG No data
Right 1114850202 14:26374190-26374212 TGAACGTGGCAGGAACACTGAGG No data
1114850194_1114850202 15 Left 1114850194 14:26374152-26374174 CCTAGGAGTGTATGCATCCTTAG No data
Right 1114850202 14:26374190-26374212 TGAACGTGGCAGGAACACTGAGG No data
1114850193_1114850202 29 Left 1114850193 14:26374138-26374160 CCATTTAGGACTTTCCTAGGAGT No data
Right 1114850202 14:26374190-26374212 TGAACGTGGCAGGAACACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114850202 Original CRISPR TGAACGTGGCAGGAACACTG AGG Intergenic