ID: 1114850203

View in Genome Browser
Species Human (GRCh38)
Location 14:26374214-26374236
Sequence ACGCTGATTCCTGAGAGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 4, 3: 12, 4: 169}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114850196_1114850203 22 Left 1114850196 14:26374169-26374191 CCTTAGGTTGCTCCCAGCCAATG No data
Right 1114850203 14:26374214-26374236 ACGCTGATTCCTGAGAGATGAGG 0: 1
1: 0
2: 4
3: 12
4: 169
1114850200_1114850203 9 Left 1114850200 14:26374182-26374204 CCAGCCAATGAACGTGGCAGGAA No data
Right 1114850203 14:26374214-26374236 ACGCTGATTCCTGAGAGATGAGG 0: 1
1: 0
2: 4
3: 12
4: 169
1114850201_1114850203 5 Left 1114850201 14:26374186-26374208 CCAATGAACGTGGCAGGAACACT No data
Right 1114850203 14:26374214-26374236 ACGCTGATTCCTGAGAGATGAGG 0: 1
1: 0
2: 4
3: 12
4: 169
1114850199_1114850203 10 Left 1114850199 14:26374181-26374203 CCCAGCCAATGAACGTGGCAGGA No data
Right 1114850203 14:26374214-26374236 ACGCTGATTCCTGAGAGATGAGG 0: 1
1: 0
2: 4
3: 12
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114850203 Original CRISPR ACGCTGATTCCTGAGAGATG AGG Intergenic