ID: 1114850204

View in Genome Browser
Species Human (GRCh38)
Location 14:26374215-26374237
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114850201_1114850204 6 Left 1114850201 14:26374186-26374208 CCAATGAACGTGGCAGGAACACT No data
Right 1114850204 14:26374215-26374237 CGCTGATTCCTGAGAGATGAGGG No data
1114850199_1114850204 11 Left 1114850199 14:26374181-26374203 CCCAGCCAATGAACGTGGCAGGA No data
Right 1114850204 14:26374215-26374237 CGCTGATTCCTGAGAGATGAGGG No data
1114850196_1114850204 23 Left 1114850196 14:26374169-26374191 CCTTAGGTTGCTCCCAGCCAATG No data
Right 1114850204 14:26374215-26374237 CGCTGATTCCTGAGAGATGAGGG No data
1114850200_1114850204 10 Left 1114850200 14:26374182-26374204 CCAGCCAATGAACGTGGCAGGAA No data
Right 1114850204 14:26374215-26374237 CGCTGATTCCTGAGAGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114850204 Original CRISPR CGCTGATTCCTGAGAGATGA GGG Intergenic