ID: 1114850207

View in Genome Browser
Species Human (GRCh38)
Location 14:26374232-26374254
Sequence TGAGGGATTTCTCTGACAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114850200_1114850207 27 Left 1114850200 14:26374182-26374204 CCAGCCAATGAACGTGGCAGGAA No data
Right 1114850207 14:26374232-26374254 TGAGGGATTTCTCTGACAGGTGG No data
1114850201_1114850207 23 Left 1114850201 14:26374186-26374208 CCAATGAACGTGGCAGGAACACT No data
Right 1114850207 14:26374232-26374254 TGAGGGATTTCTCTGACAGGTGG No data
1114850199_1114850207 28 Left 1114850199 14:26374181-26374203 CCCAGCCAATGAACGTGGCAGGA No data
Right 1114850207 14:26374232-26374254 TGAGGGATTTCTCTGACAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114850207 Original CRISPR TGAGGGATTTCTCTGACAGG TGG Intergenic