ID: 1114850634

View in Genome Browser
Species Human (GRCh38)
Location 14:26378839-26378861
Sequence GAACAGGTCAGTGCAAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114850631_1114850634 4 Left 1114850631 14:26378812-26378834 CCTACTTTCAATTACATGCAAAT 0: 26
1: 115
2: 189
3: 287
4: 465
Right 1114850634 14:26378839-26378861 GAACAGGTCAGTGCAAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114850634 Original CRISPR GAACAGGTCAGTGCAAATTG AGG Intergenic
No off target data available for this crispr