ID: 1114860725

View in Genome Browser
Species Human (GRCh38)
Location 14:26517228-26517250
Sequence TAGCAGCAGCAGAATGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 510
Summary {0: 1, 1: 0, 2: 6, 3: 41, 4: 462}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114860725_1114860726 1 Left 1114860725 14:26517228-26517250 CCTTGCTCATTCTGCTGCTGCTA 0: 1
1: 0
2: 6
3: 41
4: 462
Right 1114860726 14:26517252-26517274 ACCAGCCTTCTTGAAGTACCTGG 0: 1
1: 0
2: 1
3: 5
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114860725 Original CRISPR TAGCAGCAGCAGAATGAGCA AGG (reversed) Intronic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
900696630 1:4016170-4016192 CCGCAGCAGAAGAATGGGCAAGG + Intergenic
900909632 1:5585939-5585961 TAGCAGCAGAACAGTCAGCAAGG + Intergenic
901110262 1:6787639-6787661 AAGCAGCAGCAGAAGAATCACGG + Intronic
901354643 1:8634155-8634177 TAGTAGCAGCAGCGTGAGGATGG - Intronic
901369471 1:8784111-8784133 TGGTGGGAGCAGAATGAGCAGGG - Intronic
903024163 1:20415413-20415435 TGGCTGCAGCAGAGTGACCAAGG + Intergenic
903117830 1:21192678-21192700 TGGCAGCAGGAGAGTGAGGAAGG - Intergenic
903190617 1:21653672-21653694 TAGTAGCAGCAGCAGCAGCAGGG + Intronic
903296045 1:22343675-22343697 TGGCTGCAGCAGAGTGGGCAAGG + Intergenic
903543694 1:24110794-24110816 AAGAAAGAGCAGAATGAGCAGGG - Intronic
903788183 1:25875197-25875219 TGGGAGGAGCAGAAGGAGCACGG - Intergenic
905003309 1:34690539-34690561 CACAAGCTGCAGAATGAGCAAGG + Intergenic
905128069 1:35729951-35729973 TACAAGCTGCAGAAAGAGCAAGG + Intronic
905605349 1:39293657-39293679 TAACAGCAGCAGAAGGAGACAGG + Intronic
905972652 1:42153491-42153513 CAGCAGCAGCAGGAGGACCACGG - Exonic
906156777 1:43618610-43618632 TACCTGCAGGAGGATGAGCAGGG - Exonic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
906613603 1:47220102-47220124 TGGCGGCAGCAGAATGTGAACGG - Exonic
907184311 1:52598120-52598142 TGGCTGGAGCAGAGTGAGCAAGG - Intergenic
907615750 1:55924556-55924578 TGGCTGGAGCAGAATGAACATGG + Intergenic
908390661 1:63680699-63680721 AAGAGGCAGCAGAATTAGCATGG + Intergenic
908467150 1:64407808-64407830 TACCAGGAGCTGAATGGGCAAGG - Intergenic
908543922 1:65146983-65147005 CAGCACCAGCATAATGCGCATGG + Intergenic
908825979 1:68133064-68133086 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
909170026 1:72282963-72282985 CAGCAGCAGCAGAAGCAGCGCGG + Intergenic
909563118 1:77026572-77026594 AAGCAGCAGCATAATATGCAGGG + Intronic
909920261 1:81373054-81373076 TAGCAGCATTAGCATGACCATGG - Intronic
912145325 1:106786686-106786708 TAGCAGCAGCAGAAGGACACGGG - Intergenic
912643812 1:111372223-111372245 TGGCAGCAGCAGCAAGTGCATGG + Intergenic
913007808 1:114651959-114651981 GAGCTTCAGCAGAATGAGGAGGG + Intronic
913234854 1:116770972-116770994 TAGAGGCAACAGCATGAGCAAGG + Intergenic
913252924 1:116927085-116927107 AAACAGAAGCAGAAAGAGCAAGG + Intronic
913368985 1:118075743-118075765 TATCTGGAGTAGAATGAGCAAGG - Intronic
914826687 1:151142574-151142596 CAGCAGCAGCAGTAGCAGCAAGG + Exonic
915168307 1:153960765-153960787 AAGCAGCAGCAAAATGTTCAGGG + Intronic
917109839 1:171536050-171536072 TGGCAGCAGCAGCAACAGCAAGG + Exonic
917180391 1:172290466-172290488 TGGCTGGAGCAGAATGAGGATGG + Intronic
917284143 1:173407015-173407037 CAGCAGCAGCAGGATGAGAAGGG + Intergenic
917494020 1:175523958-175523980 TAGGAGGAGCAGCATGGGCAAGG - Intronic
917751179 1:178055016-178055038 TAGGAGCAGAAGAATGGGCGTGG + Intergenic
917829654 1:178866929-178866951 TAGCAGAAGTAGAATGGGTAAGG + Intronic
918048922 1:180957544-180957566 TAGCAGCAGCTGTTTGTGCAGGG - Intergenic
918121294 1:181543234-181543256 CAGCAGCATCAGCATCAGCAGGG - Intronic
918547012 1:185696517-185696539 TAGCTGCAGCAGAAGGAGGACGG - Intergenic
919812150 1:201415475-201415497 CAGCAGCAGCAGAATCAGAGTGG - Intronic
919823488 1:201487699-201487721 TAGTAACAGCAGTAAGAGCAAGG + Intronic
920641919 1:207760785-207760807 TGGCAGGAGCAGGAGGAGCAAGG + Intronic
921164857 1:212499648-212499670 TGGCTGGAGCAGAGTGAGCAGGG + Intergenic
921562753 1:216677945-216677967 TTGCAGCATCAGAATGAGGAAGG - Intronic
921740608 1:218680575-218680597 TGGCAGAAGCACAGTGAGCATGG + Intergenic
921812362 1:219529419-219529441 GAGCAGCAGCAGCAGCAGCAGGG + Intergenic
922002460 1:221493880-221493902 GAGCAAGAGCAGAGTGAGCAAGG - Intergenic
922709378 1:227815760-227815782 GAGCAGCAGCAGAAGGCCCAGGG - Exonic
922983365 1:229847578-229847600 CAGGAGCAGCAGAATGACCAAGG + Intergenic
923445421 1:234066384-234066406 TAGTTGGGGCAGAATGAGCAAGG - Intronic
923683990 1:236141994-236142016 AATCAGCAGCAGAATGCGCGAGG + Intergenic
1064392968 10:14957468-14957490 TGGCTGCAGCAGAATGATCCGGG + Intergenic
1064559880 10:16585507-16585529 TGGCAGCATCAGAATGTGCTGGG + Intergenic
1065223978 10:23524218-23524240 TAGGAGCAGGAGCAGGAGCAGGG + Intergenic
1067329741 10:45303954-45303976 TTACAGCAGCATGATGAGCAAGG - Exonic
1068243017 10:54329289-54329311 TAACAGCAGCAGAATCACCTTGG - Intronic
1069333258 10:67318588-67318610 TAGCTGGAGCAGAGTGAACATGG - Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070377975 10:75852844-75852866 TAGCATGAGCAGCATGAGAACGG - Intronic
1070639673 10:78158666-78158688 TAGCAGCAGCAATTTCAGCAGGG + Intergenic
1070718898 10:78742949-78742971 CAGCAGCAGCAAAATAAACAAGG + Intergenic
1071396146 10:85225958-85225980 AAGCAGGAGCAGAGAGAGCATGG + Intergenic
1071397456 10:85237969-85237991 GAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1071777572 10:88806341-88806363 CAGGAGGAGCAAAATGAGCAGGG - Intronic
1072047590 10:91672226-91672248 TAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1072612386 10:97026773-97026795 TAGCAGCAGAGGATTGTGCAGGG + Intronic
1073308182 10:102519641-102519663 CAGAAGCAGCAGCATGACCATGG - Intronic
1073404647 10:103286656-103286678 TAGCAGCAACACAACAAGCAAGG + Intronic
1074210001 10:111322524-111322546 TGGCAGCAGCAGTAGGAGGATGG + Intergenic
1074274476 10:111988317-111988339 CATCAGCAGCCCAATGAGCAAGG - Intergenic
1074944124 10:118264704-118264726 TAGCAGGAAGAGAAGGAGCAGGG + Intergenic
1075960064 10:126560725-126560747 TAGCAGCAACAGAGACAGCATGG - Intronic
1078001410 11:7499680-7499702 TAGGAGAAGCAGAAGGAACATGG + Intronic
1078074796 11:8148794-8148816 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1078277494 11:9864060-9864082 TAGCAGGAGCAGAAAGAGAATGG + Intronic
1078357948 11:10646881-10646903 TAGCTGAAGGAGAATGAGGAAGG - Intronic
1078865249 11:15291255-15291277 TGGCAGCAGGAGGGTGAGCAGGG + Intergenic
1080172073 11:29316441-29316463 TCGCAGTAGGAGAATGACCAAGG + Intergenic
1080229452 11:30002488-30002510 CAGCAGCAGCTAAATCAGCAAGG + Intergenic
1080302358 11:30798654-30798676 TAGCAGTAGCAGAATCAGTTGGG + Intergenic
1080746781 11:35115492-35115514 AAGCAGCAGCAAAATGAGAGAGG + Intergenic
1081161374 11:39754174-39754196 AAGCAGCAGCAGAGTCTGCACGG - Intergenic
1081468328 11:43345898-43345920 TGGCTGCAGCAGAGTGATCAAGG - Intergenic
1084098378 11:66928447-66928469 TGGCAGCAGCAGAATGACCATGG + Intronic
1084453614 11:69254613-69254635 TAGCAGCAGTGGAAACAGCAGGG + Intergenic
1084764967 11:71302241-71302263 CAGCAGCAGCAGTAGGAGCATGG + Intergenic
1084927547 11:72525566-72525588 TGGCAGCTGCAGAAGGAACATGG - Intergenic
1084948546 11:72652120-72652142 GAGCAGCATGAGAATAAGCAAGG + Intronic
1085131011 11:74038600-74038622 TATCAGCAGAAGTATGAGGAAGG - Intronic
1085446815 11:76606298-76606320 TTGCAGCAGAAGAGTGAGAAGGG - Intergenic
1085586181 11:77708808-77708830 TAGCTGAAGCAGAATGAGTGGGG - Intronic
1085862107 11:80246256-80246278 TGGCTGGAGCAGGATGAGCAGGG + Intergenic
1086008006 11:82063205-82063227 TACCAACATCTGAATGAGCAAGG + Intergenic
1086182713 11:83973613-83973635 TGGTAGCAGCAGAATGGGCTAGG + Intronic
1086586014 11:88452043-88452065 CAGCAGAAGCAAAATAAGCATGG - Intergenic
1087946431 11:104165099-104165121 GAGCAGGAACAGACTGAGCAAGG + Intergenic
1088279854 11:108124742-108124764 TGGCAAAAGCAGAGTGAGCACGG - Intronic
1089001309 11:115054545-115054567 AAGCAGCAGGAGAAAGGGCAGGG + Intergenic
1089535165 11:119156544-119156566 GAGCTGCAGCAGAAAGAGAAGGG - Exonic
1089536307 11:119162478-119162500 AATCAGAAGCAGAATGAGCCTGG - Exonic
1091206789 11:133827036-133827058 TGGCTGCAGCAGAGGGAGCAAGG - Intergenic
1091293232 11:134454106-134454128 CAGCAGCAGCAGCAGAAGCAGGG - Intergenic
1091305886 11:134535833-134535855 TAAGAGCAGCAGGAGGAGCACGG - Intergenic
1091563522 12:1631353-1631375 CAGCAGCAGCAGGCTGGGCATGG - Exonic
1092153091 12:6264566-6264588 TGGCAGCAGCAGCAGAAGCAGGG + Intergenic
1092836456 12:12493610-12493632 TGGCTGGAGCAGAGTGAGCATGG - Intronic
1094232411 12:28122324-28122346 AAGAAGCAGAAGAATGAGGAGGG + Intergenic
1096374778 12:51099678-51099700 CAGCAGCAGAAGCATGAGGATGG - Exonic
1096688596 12:53305669-53305691 TTTGTGCAGCAGAATGAGCATGG + Intronic
1097626434 12:62007107-62007129 TGGCTGGAGCAGAAGGAGCATGG - Intronic
1098498544 12:71165065-71165087 TGGCTGCAGCAGCATGAGTAAGG - Intronic
1100029665 12:90170705-90170727 TAGCAAATGCAGAATGAGAAAGG + Intergenic
1100255144 12:92875787-92875809 TAGCTGTAGCATAGTGAGCAAGG - Intronic
1100280393 12:93112863-93112885 GGGCAGCAGCAGAAGGACCAAGG - Intergenic
1100415543 12:94369884-94369906 AAGCAGCAGCAGCAGCAGCAAGG + Intronic
1101168560 12:102063905-102063927 TAGCTGAAGCAGAGTGAGCAAGG + Intergenic
1101335465 12:103792408-103792430 TACCAGCTGCAGAATAAACATGG + Intronic
1101980154 12:109399051-109399073 GAGCAGCAGCTGTATGAGCACGG + Intronic
1102119327 12:110428761-110428783 ATGCTGCAGCAGAGTGAGCAAGG - Intergenic
1102408411 12:112694508-112694530 CAGCAGCAGCAGCATAAGAAAGG + Intronic
1103643280 12:122370216-122370238 TAGCTGAAGCAGAGTGAGAAAGG + Intronic
1104021248 12:124993828-124993850 CAGCAGCAGCAGCAGGAGCCCGG - Exonic
1104023273 12:125008098-125008120 TAGCAGCAGCAGCATCACCCAGG - Intronic
1104209672 12:126676729-126676751 TAGCAGCAGCAGACCCAGTATGG - Intergenic
1105390315 13:19971038-19971060 TAGCTGAAGCTTAATGAGCAAGG + Intronic
1105858949 13:24392992-24393014 TGGCAGCAGCTGCATGAGCCAGG - Intergenic
1106500482 13:30323630-30323652 TTGCAGCAGCAGTAGGAGGAGGG + Intergenic
1106527177 13:30551518-30551540 TAGCAGCAGTTTAATGAGAATGG - Intronic
1106916239 13:34518270-34518292 TAGCAGCAGTAAAATCAGCACGG - Intergenic
1106995557 13:35476295-35476317 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1107626008 13:42284867-42284889 TTGAAGCAGCAGCATGAGAAAGG - Intronic
1108727582 13:53200039-53200061 CAGCAGCCACAGAATCAGCAAGG - Intergenic
1109035566 13:57255862-57255884 TTGCAGCAGCAGAGTGCTCAAGG - Intergenic
1110503928 13:76262229-76262251 GAGCAGCAGCAGGATGTGCTTGG + Intergenic
1110714060 13:78681921-78681943 TAGTCGCAGCAGGAAGAGCAAGG + Intergenic
1111716292 13:91883623-91883645 TAGCTGAAGCAGAGTGAGGAAGG + Intronic
1113453524 13:110430762-110430784 TAACAGCAGCAAAGTGTGCAAGG - Intronic
1113540019 13:111100022-111100044 TAGGAACAGAAGAATGAGGAAGG + Intergenic
1114860725 14:26517228-26517250 TAGCAGCAGCAGAATGAGCAAGG - Intronic
1115427529 14:33277744-33277766 TTGCTGGAGCAGAATGAGAAAGG + Intronic
1115944846 14:38648455-38648477 CAGCAGCAGCAAAATGAGTTAGG + Intergenic
1116474913 14:45328631-45328653 CAGCAGGATAAGAATGAGCAAGG + Intergenic
1117337756 14:54769186-54769208 TACCTGCAGCAGAATTACCAGGG + Intronic
1118835272 14:69473458-69473480 TAGCAGTATCAGAAAGGGCATGG + Intergenic
1119016672 14:71064391-71064413 TAGCAGCAGAATAAGGAGAATGG - Intronic
1119220162 14:72900144-72900166 TTCCAGCAGCAGCATGACCATGG + Intergenic
1119395168 14:74320924-74320946 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
1119433085 14:74581065-74581087 GAGCAGAAGCAGGATGAACACGG + Intronic
1119618567 14:76114493-76114515 CAGCAGCAGCAGAAGCAGCATGG + Intergenic
1119748438 14:77061011-77061033 TAGCAGCATAAGAATCACCAAGG + Intergenic
1121195847 14:92071009-92071031 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1121337461 14:93086081-93086103 TAGTATCAGCCTAATGAGCAAGG + Intronic
1121540343 14:94721100-94721122 TACCAGTAGTAGAAGGAGCATGG + Intergenic
1121633657 14:95439435-95439457 TAGCAGGAGCAGGAGGAGCCAGG - Intronic
1122155239 14:99746727-99746749 CACCAGCAGCAGAATGGGGATGG - Intronic
1122363955 14:101183410-101183432 TGGCGGCAGCTGCATGAGCAGGG - Intergenic
1122369837 14:101223418-101223440 TAGCTGCATCAGAAAGAGCCGGG + Intergenic
1122492852 14:102131510-102131532 TGGCTGGAGCAGAGTGAGCAGGG - Intronic
1123737184 15:23196650-23196672 TAGCTGGAGTAGAATGAGAAGGG + Intergenic
1124288400 15:28425312-28425334 TAGCTGGAGTAGAATGAGAAGGG + Intergenic
1124294824 15:28492002-28492024 TAGCTGGAGTAGAATGAGAAGGG - Intergenic
1124929124 15:34101789-34101811 TAGCAGCAGCAGCAGCAGGACGG + Exonic
1125933958 15:43618681-43618703 CAGCAGCAGCAGCAGCAGCAGGG + Exonic
1125947055 15:43718143-43718165 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1126356587 15:47802431-47802453 CAGCAGCAGCAGAGTCATCAGGG - Intergenic
1127102943 15:55586597-55586619 TAACTGCAGCAAAGTGAGCAAGG - Intronic
1127135035 15:55911103-55911125 TGGCAGCAGCAGCATATGCAAGG - Intronic
1127745817 15:61971084-61971106 TGGCTGAAGCAGAGTGAGCAAGG + Intronic
1128767561 15:70260489-70260511 CTGCAGCAGCAGAATGAGTGTGG - Intergenic
1129600446 15:76995340-76995362 AATCAGCAGCAAAATGAGGAAGG - Exonic
1129741558 15:77992063-77992085 CAGCGGCAGCAGCAGGAGCAAGG + Intronic
1129919913 15:79311278-79311300 GAGCAGCAGCAGAAGCAGCACGG - Exonic
1131348890 15:91678506-91678528 TAGCAGCAGAAGCATCACCAGGG + Intergenic
1131877470 15:96825803-96825825 AAGCAGCAGCAGAAGCAGGATGG - Intergenic
1132032520 15:98450322-98450344 TAGAAGGAGCAGCATGAGCCAGG + Intronic
1132530950 16:449146-449168 TGTCAGGAGCAGAGTGAGCAGGG - Intronic
1132747327 16:1442488-1442510 TTGCTGCAGCAGGAGGAGCAGGG - Exonic
1133303317 16:4795951-4795973 CAGCAGCAGCAGGAGCAGCACGG - Exonic
1133621492 16:7530923-7530945 CAGCAGCAGCAGAATGTACCTGG + Intronic
1133621723 16:7532636-7532658 TAACATCAGCAGAAGTAGCAAGG + Intronic
1135338583 16:21626860-21626882 TAGCAGGAGATGAAAGAGCAGGG + Intronic
1136749357 16:32619235-32619257 CAGCAGCACCAAAATGAGCCTGG + Intergenic
1137381341 16:48002497-48002519 TAACACCAGTAGACTGAGCAGGG + Intergenic
1137655305 16:50153771-50153793 CAGCAGCAGCAGCAGCAGCACGG + Exonic
1138695179 16:58806455-58806477 TATCAGCAGCAGTATGAAAATGG - Intergenic
1139099189 16:63744640-63744662 TAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1139347963 16:66316642-66316664 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1139389895 16:66600759-66600781 CAGCAGCAGCAGAAAAAGCTGGG + Intergenic
1140636807 16:76924565-76924587 TAGTAGCATCAGAATGACCAAGG - Intergenic
1141927092 16:87177096-87177118 GAGCAGGACCAGAGTGAGCAGGG - Intronic
1203051489 16_KI270728v1_random:878449-878471 CAGCAGCACCAAAATGAGCCTGG + Intergenic
1142790800 17:2264110-2264132 TAGCAGCTGCAGATTGAACAAGG + Intronic
1143685716 17:8514145-8514167 TGGCAGCAGGAGAATGTGCAGGG - Intronic
1143964522 17:10747482-10747504 AAGCAGCAGCAGAGGGAGCGAGG - Intergenic
1144065761 17:11622764-11622786 AAGCAGCAGCAGCCTGAGAAAGG - Intronic
1144132205 17:12257272-12257294 AAGCAGCAGCAGCAAGATCAGGG + Intergenic
1144341420 17:14313333-14313355 TAGCAGCTGCAGAGTAAGTAAGG - Intronic
1144517156 17:15926589-15926611 TGTGAGCAGCAGAATGGGCAAGG + Intergenic
1145898418 17:28474196-28474218 AAGCAGCAGCAGAGTGAAGAGGG + Intronic
1145901262 17:28491792-28491814 CAGCAGCAGCAAGATGACCATGG - Exonic
1147655745 17:42089760-42089782 TCTCAGCAGCAGAATGTGTACGG + Intergenic
1148184775 17:45634182-45634204 CAGCTGGAACAGAATGAGCAGGG + Intergenic
1148988635 17:51646429-51646451 TAGCAACAGTAGAATGGGCAGGG + Intronic
1149781842 17:59403755-59403777 AAGCAGCACCAGAATTAACATGG - Intergenic
1150909356 17:69371795-69371817 TGGCCTCAGCAGAATGAGCAAGG + Intergenic
1152460669 17:80440623-80440645 CACCAGCAGCAACATGAGCATGG - Intergenic
1152651377 17:81495056-81495078 GAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1155403166 18:25460525-25460547 TTGCAGAAGCAGAAAGAGAATGG + Intergenic
1157267279 18:46237151-46237173 TAACAGAAGCTGACTGAGCATGG - Intronic
1157878480 18:51295646-51295668 TAGCAGCATCAGTATCAGCTGGG - Intergenic
1159807543 18:72974352-72974374 TGGCTGGAACAGAATGAGCAGGG - Intergenic
1160676319 19:393277-393299 TGGCTGCAGCAGACTGAGTAAGG + Intergenic
1160699545 19:499146-499168 TGGCTGCAGCAGAATGAGGAGGG - Intronic
1161267901 19:3373442-3373464 TGGCTGGAGCAGAATGAGCAAGG - Intronic
1161414742 19:4139698-4139720 TAGCTATAGCAGAGTGAGCAAGG + Intergenic
1161431290 19:4233705-4233727 TGGCCACAGCAGAGTGAGCAAGG - Intronic
1161490505 19:4558401-4558423 TAGCAGCAGCAGAAGCAGCAGGG + Exonic
1161599168 19:5170422-5170444 TGGCTGCAGCAGAGTGAGCCAGG + Intronic
1161644512 19:5444743-5444765 TGGCTGCAGCAGAGGGAGCAAGG - Intergenic
1161649887 19:5477958-5477980 TGGCTGCAGCAGAGTGAGGAGGG - Intergenic
1161756423 19:6137447-6137469 TGGCTGCAGCAGAGTGAGGAGGG + Intronic
1162589807 19:11584115-11584137 TGGCTGGAGCAGAGTGAGCAAGG + Intronic
1165923904 19:39315265-39315287 GAGCAGCAGCAGAAAGGGCAGGG + Exonic
1166189578 19:41167080-41167102 TTCCAGCACCTGAATGAGCAGGG - Intergenic
1166673940 19:44727822-44727844 TAGCTGGAGCAGGATGAGCTGGG - Intergenic
1166891550 19:45997066-45997088 TGGCTGCAGCAGAGTGAGCCAGG - Intronic
1167341992 19:48921854-48921876 CAGCAGCAGCAGCAGCAGCAAGG + Exonic
1167880816 19:52455962-52455984 TAGCTACAGCAGAGGGAGCAAGG - Intronic
1168468975 19:56625645-56625667 TGGCTGAAGCAGAGTGAGCAGGG - Exonic
1168712892 19:58511911-58511933 GAGCAGCAGCAGCAGCAGCAAGG + Exonic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925568026 2:5277717-5277739 TAGCAGCAGGAGCAGCAGCAGGG + Intergenic
925733714 2:6942483-6942505 TAGCAGTAGCAGCAGCAGCAGGG + Intronic
925852963 2:8101040-8101062 TTGAAGAAGCAGAAAGAGCAAGG - Intergenic
926231583 2:11008234-11008256 GAGCTGCAGCAGAAGGAGGAAGG - Intergenic
927205650 2:20608723-20608745 TTGGGGCAGCAGAGTGAGCAAGG - Intronic
927257913 2:21056424-21056446 CAGCAGCAGCAGAATAACCCAGG + Intergenic
927553723 2:24018550-24018572 ATGCTGCAGCAGAGTGAGCAAGG + Intronic
927944764 2:27129031-27129053 AAGCAGCAGCACAATGGGCTGGG - Exonic
928097685 2:28414499-28414521 TCCAAGCAGCAGAATGAGCCAGG + Exonic
928325881 2:30319167-30319189 CAGCAGCAGCAGAAAGAGGTGGG + Intronic
929414096 2:41729838-41729860 TGGAAGCAGCAGAATGCCCAGGG - Intergenic
929604195 2:43224599-43224621 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
930837067 2:55805692-55805714 AAGCAGCAGCAGAATTAACATGG - Intergenic
931243273 2:60471384-60471406 AAGAAGCAGCAGAATCAGCTGGG - Intronic
931743072 2:65266426-65266448 TGGCTGGAGCAGAGTGAGCAAGG + Intronic
931842411 2:66168330-66168352 TAGCTAGAGCAGAATGAGCAGGG + Intergenic
931909895 2:66887820-66887842 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
932634195 2:73373605-73373627 TAGCAACAGCCAAAGGAGCAAGG - Intergenic
933336321 2:80964195-80964217 TAGCAGCAGCAGCAGCAGCATGG + Intergenic
934161657 2:89255241-89255263 CAGCTGAAGCAGGATGAGCAGGG + Intergenic
934205627 2:89927174-89927196 CAGCTGAAGCAGGATGAGCAGGG - Intergenic
935848116 2:107188213-107188235 CAGCAGCAGCAGTAACAGCACGG - Intergenic
935860008 2:107319400-107319422 TAGCAGCAGCAGGAAGAGAAAGG - Intergenic
937972780 2:127563585-127563607 TTGCTGCAGCAGTAGGAGCAAGG - Intronic
938260397 2:129891752-129891774 CAGCAGCAGCAGGAGGAGGATGG - Intergenic
938293816 2:130164313-130164335 AAGAAGCAGCAGGCTGAGCAGGG + Intronic
938462728 2:131508649-131508671 AAGAAGCAGCAGGCTGAGCAGGG - Intergenic
939712219 2:145536547-145536569 TAGCAGCAGTTGAATCTGCAGGG + Intergenic
940120508 2:150259415-150259437 TAGCAGCAGATGAAAGTGCAGGG + Intergenic
940214717 2:151292666-151292688 TAGCAACAGCAGCATAAGCTTGG - Intergenic
941758773 2:169217819-169217841 TAGCAGCAGATGAAAGATCAAGG - Intronic
941913745 2:170793616-170793638 TAACTGGAGCAGAATGAGCATGG + Intronic
942228098 2:173834569-173834591 GAGCAGGAGCAGAATGAAAATGG + Intergenic
943273078 2:185832303-185832325 CAACAGCAGCAGATTGAGCAGGG + Intronic
943317315 2:186406161-186406183 TAGAATCAACAGAAAGAGCATGG - Intergenic
944388759 2:199194931-199194953 GAGGAGGAGGAGAATGAGCAGGG - Intergenic
944781787 2:203026022-203026044 TAGAAGCAGAAGAATTAGAAGGG - Intronic
946977060 2:225164719-225164741 CAGCAGCAGCAGCAGCAGCAAGG - Intergenic
1169006989 20:2215881-2215903 TAGCAGCAGCAAAAGGGGCGTGG - Intergenic
1169817585 20:9674133-9674155 CAGCAGAAACAGAATGAGAATGG + Intronic
1170099167 20:12679632-12679654 TAGCAGAATCAGAATGTGCGTGG + Intergenic
1170411190 20:16093894-16093916 TAGGAGCCCCAGAATAAGCATGG - Intergenic
1170707825 20:18761202-18761224 TAGCTGCAGCACACCGAGCAGGG - Intronic
1170709852 20:18780812-18780834 TGGCAGCAGCATCATGTGCAGGG - Intergenic
1170781326 20:19428148-19428170 CAGTAGCAGCAGCATGAGCCCGG + Intronic
1173620116 20:44430115-44430137 CAGCAGCAGAAGGAGGAGCAAGG - Exonic
1173818990 20:46008752-46008774 TGGCAGCACCAGCATGAGAAAGG - Intergenic
1174421246 20:50400444-50400466 TGGCTGCAGCAGAATGAGTGAGG + Intergenic
1174584699 20:51599093-51599115 CAGCAGAAGCAGAATGAAGATGG - Exonic
1174882166 20:54291869-54291891 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1175270702 20:57731923-57731945 TGGCAGCAGGAGAGAGAGCACGG + Intergenic
1175498893 20:59435408-59435430 AAACAGCAGCAGGATGAGGAGGG + Intergenic
1175501060 20:59451160-59451182 TAGAAGCAGCAGCAGCAGCAAGG - Intergenic
1175983669 20:62753789-62753811 TGGCAGCAGCAGAACCAGCCAGG - Intronic
1177079390 21:16619824-16619846 TGGCTGAAGGAGAATGAGCAAGG + Intergenic
1177138954 21:17337986-17338008 TAGCAGCACTGTAATGAGCAGGG - Intergenic
1177237569 21:18412722-18412744 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1178135264 21:29619774-29619796 AAGCAGCAACAGAAGCAGCATGG + Intronic
1178154730 21:29838499-29838521 GAGCAGCAGAAGAGTGAGTAGGG - Intronic
1178854605 21:36239881-36239903 CTGCAGCAGCAGCAGGAGCACGG - Exonic
1179156184 21:38853069-38853091 TATCAGCAGCTGAAGGATCAAGG - Intergenic
1180008456 21:45034152-45034174 TGGCATCAGCAGAACCAGCATGG - Intergenic
1180030910 21:45206960-45206982 CAGCAGCAGCAGAGAGAGCCTGG + Intronic
1180871633 22:19150075-19150097 CAGCAGCAGCAGCAGGCGCAGGG + Exonic
1181113162 22:20613600-20613622 AAGAAGCAGCAGGCTGAGCATGG + Intergenic
1181493945 22:23277510-23277532 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1182123130 22:27799612-27799634 CAGCAGCAGCAGCAGCAGCATGG - Exonic
1182263055 22:29089741-29089763 CTGGAGCAGGAGAATGAGCAGGG - Intronic
1183149258 22:36025186-36025208 TAGCTGGAGCAGAGAGAGCAAGG - Intronic
1183303168 22:37068528-37068550 GAGCAGTAGCAGGAAGAGCAGGG + Intronic
1184507583 22:44913770-44913792 TGGCACCTGCAGACTGAGCAGGG + Intronic
1184559685 22:45254878-45254900 CAGCGGCAGCAGAATCAGCAGGG - Intergenic
951145207 3:19218733-19218755 TAGCACCAACAGAGGGAGCAGGG - Intronic
951710505 3:25581508-25581530 TAGAAGCAGTAGCGTGAGCAGGG + Intronic
952461925 3:33536527-33536549 TGGCAGGAGCAGAGTGAACAAGG + Intronic
952847009 3:37696234-37696256 AAGCACCAGCAGAGTCAGCAGGG + Intronic
953170142 3:40499802-40499824 GAGAAGCAGCAGCAAGAGCATGG - Intergenic
953901046 3:46844601-46844623 CAGCAGCCCCAGAAGGAGCAGGG - Intergenic
955018566 3:55096310-55096332 TGGCTGCAGCAGAGTGAGCAAGG - Intergenic
955209607 3:56928506-56928528 TTGCAGCAGGAAAATGACCATGG + Intronic
956423865 3:69112729-69112751 AAGCAGCAGCAGCATTACCAGGG + Intronic
957626901 3:82664822-82664844 AAGCAGCAGCAGGATTTGCACGG - Intergenic
957909297 3:86601692-86601714 TAGAACCATCAGAAAGAGCATGG - Intergenic
957953291 3:87151241-87151263 TAGCAGCAGGAGAGAGAGCGAGG + Intergenic
958830990 3:99088979-99089001 TAGCTGGAGCACTATGAGCAAGG + Intergenic
959291086 3:104475133-104475155 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
959637127 3:108588178-108588200 CAGAAGCCGCAGAATAAGCAGGG - Intronic
960294591 3:115927635-115927657 TGGCCGAAGCAGAGTGAGCAAGG - Intronic
961883997 3:130083823-130083845 GAGCAGCTGCAGAATTTGCAAGG - Intronic
962354086 3:134678756-134678778 TAGCAGCAGCACAGTGAGGTGGG - Intronic
962753087 3:138449046-138449068 AGGCAGCAACAGAATGACCAAGG - Intronic
963587718 3:147214245-147214267 TAGGACCAGCAGAAATAGCAGGG + Intergenic
963809991 3:149766862-149766884 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
964546831 3:157843566-157843588 CAGCAGCAGCAAAATGAGCAAGG + Intergenic
965392448 3:168121332-168121354 TAGCAGCTGCAGGATGGGAAAGG - Intergenic
966448178 3:180027116-180027138 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
966497081 3:180593307-180593329 TGGCAGGAACAGAGTGAGCATGG - Intergenic
966565499 3:181376263-181376285 TAGCAAAAGCAGACTGAGAAAGG + Intergenic
966605853 3:181820929-181820951 TGGCTGGAGCAGAGTGAGCAGGG - Intergenic
967572400 3:191045292-191045314 AAGCAGCAGCAGAATTTGAAAGG + Intergenic
967681572 3:192370002-192370024 GAGCAGCACCAGCAGGAGCAAGG + Intronic
967826962 3:193884746-193884768 AAGCAGCAGCAGAGTCAGCTGGG + Intergenic
967912315 3:194552511-194552533 TGGCCGCAGCAGAGTGGGCAAGG - Intergenic
968262120 3:197333974-197333996 CAGCAGCAGCAGCAGGAGCTAGG + Intergenic
969587372 4:8102163-8102185 TGGCTGAAGCAGAATGACCAAGG - Intronic
969695187 4:8730251-8730273 CAGCAGCATGAGAAGGAGCAGGG + Intergenic
970180275 4:13384370-13384392 CAGCAGCAGCAGCAGCAGCACGG - Intronic
970223209 4:13831468-13831490 CAGCTGCAGGAGAATGAGTAAGG - Intergenic
973306689 4:48659986-48660008 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
973916078 4:55636112-55636134 CAGCAGCAGCAGCAGGAGCGGGG + Exonic
974990338 4:69079152-69079174 TAACAGCAGCAGAATGGGTGAGG + Intronic
975329850 4:73100310-73100332 ATGCTGCAGCAGAGTGAGCAAGG + Intronic
975800373 4:78055280-78055302 TAGCAGCTGCAAAATTAGGAGGG + Intergenic
975842014 4:78484738-78484760 TAGAAACAGAAGAAAGAGCACGG - Intronic
976405330 4:84656024-84656046 TAGCAGCCTCAGAATGCGCCGGG - Intergenic
976621246 4:87129762-87129784 TACCAGTAGCAGAATGAACTAGG - Intronic
976758951 4:88527759-88527781 AACCGGCAGCAGAATGAACAAGG - Intronic
976855744 4:89603687-89603709 TAACAACAACAAAATGAGCAAGG + Intergenic
977036920 4:91965627-91965649 CAGGAGCAGAAGAATGATCATGG - Intergenic
977163171 4:93662024-93662046 TAGCTGGAACAGAATGAGCAAGG - Intronic
977285303 4:95098649-95098671 AAGCAGCAGCAGAATGAACCTGG - Intronic
978492978 4:109328666-109328688 TAGCAGTAGTACAATAAGCAAGG + Intergenic
978605156 4:110471860-110471882 TACCAGCATCAGAAAGAACATGG + Intronic
980563292 4:134504485-134504507 TAATAGGAGCAGAATGAACAAGG + Intergenic
981511963 4:145567024-145567046 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
981600360 4:146481400-146481422 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
981671094 4:147287773-147287795 CAGCAGCAGCAGCATGACCTGGG + Intergenic
982554688 4:156843972-156843994 TAGAAGAAGCAGAAATAGCAAGG - Intronic
982793202 4:159616183-159616205 TAGTAGCAACAGAATGAGAAGGG - Intergenic
982812544 4:159844226-159844248 TACCTGGAGCAGAGTGAGCAGGG - Intergenic
982957749 4:161792738-161792760 GAGCAGCAGCAGAATTCTCAGGG - Intronic
983130438 4:164012526-164012548 TAGCAGCAGCAGCAGCAGCCAGG + Intronic
983238646 4:165207490-165207512 CAGCAGCAGCAGCAGGAGGAAGG + Intronic
985907522 5:2852601-2852623 GAGCAGAGGCAGAAAGAGCAAGG - Intergenic
986323395 5:6652276-6652298 GGGCTGTAGCAGAATGAGCAGGG + Intronic
986688417 5:10294133-10294155 TGGCTGCAACAGAAAGAGCAAGG + Intronic
986727226 5:10608056-10608078 TAGCAACAGCAGGCTGAGTACGG + Intronic
986777303 5:11028291-11028313 TAGCAGCTGCAGAAACAGGAGGG - Intronic
988617746 5:32792238-32792260 TGGCAGCAGCAGCAGGATCAGGG - Intergenic
988998641 5:36738595-36738617 CAGAAGGAACAGAATGAGCAAGG - Intergenic
989711942 5:44409105-44409127 TAGCTGGAACAGAATGAGCAAGG + Intergenic
990722023 5:58707650-58707672 TGCCAGCATCAGAATGACCAAGG + Intronic
990825520 5:59893682-59893704 CAGCAGCAGCAGCATCAGGAAGG - Exonic
992388656 5:76310462-76310484 TGGCTGGAGCAGAATGACCAAGG + Intronic
992411041 5:76505372-76505394 TGGTAGCAGCAGAAAGAGCCTGG - Intronic
992917192 5:81468916-81468938 TGGCAGCAGCAGTACTAGCAAGG + Intronic
993409230 5:87553881-87553903 TAGCATCATGAGAATAAGCATGG + Intergenic
993873726 5:93281616-93281638 TAGAAGCAGGAGCATGGGCAGGG + Intergenic
994142076 5:96352864-96352886 TGGCAGCAGGAGAGAGAGCAAGG - Intergenic
994147527 5:96411692-96411714 AAGCAGCAGGAAAATGAGTAAGG + Intronic
994197442 5:96935977-96935999 TGGCAGCTGCAGAAAGAGCGAGG - Exonic
995377935 5:111498739-111498761 TGGCAGCAGCACAATGTTCATGG - Exonic
995614827 5:113950194-113950216 TGGGAGCAGCAGAATGAGGGAGG - Intergenic
995787445 5:115844588-115844610 TAGCAGGAGCAGACTGTGTAAGG + Intronic
996245816 5:121263058-121263080 TGCCAGCAGCAGTGTGAGCATGG + Intergenic
996552308 5:124743863-124743885 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
996854999 5:127995831-127995853 TAGCATGAGAAGAATGAGCTTGG + Intergenic
998141531 5:139702277-139702299 TGGCTGGAGCAGAAGGAGCAGGG - Intergenic
1000166151 5:158650624-158650646 TGGCTGGAGAAGAATGAGCAGGG - Intergenic
1001763965 5:174230387-174230409 TAGCTGCAGCAGAGTGAGTTTGG - Intronic
1002328909 5:178428435-178428457 TCCGAGCAGCAGAATGAGGAAGG - Intronic
1002336949 5:178486235-178486257 AGGCAGCTGCAGAATGAGGACGG + Intronic
1002340367 5:178512837-178512859 TGGCAGGAGCAGAATAGGCATGG - Intronic
1003096990 6:3149957-3149979 TAGAAGAAGCAGAATGAAAAAGG + Intronic
1003127347 6:3365823-3365845 CAGCAGCAGCAGAAGGAAAAAGG + Intronic
1003592890 6:7450474-7450496 CAGCAGCAGCAGCAGGAGAAAGG + Intergenic
1004582131 6:16964663-16964685 TCGGAGCAGAAGAAAGAGCATGG + Intergenic
1006474599 6:34246062-34246084 ATGCTGCAGCAGAGTGAGCAAGG + Exonic
1006823743 6:36918508-36918530 TGGCAGCAGCAGAGAGAACAGGG + Intronic
1006931273 6:37690083-37690105 TGGCTGGAGCAGAATGAGCCAGG - Intronic
1007335820 6:41154256-41154278 CAGGAGCAGCAGCAAGAGCAGGG + Exonic
1007576681 6:42929617-42929639 CAGCAGCAGCAGCAGCAGCAAGG - Exonic
1008095578 6:47336300-47336322 TAGCTGGAGCAGAGGGAGCATGG - Intergenic
1008555299 6:52667682-52667704 TAGCAGCTGCTGAATTAGCATGG + Intergenic
1011610397 6:89145785-89145807 CCACAGCAGCAGAATGAGAACGG - Intergenic
1012247165 6:96938632-96938654 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1012417734 6:99027779-99027801 TGGCTGCAGCTGAGTGAGCAAGG + Intergenic
1013393689 6:109713284-109713306 CAGCAGCAGCAGAGGCAGCATGG + Intronic
1013548448 6:111183178-111183200 TGGCAGAAGCAGAGTGGGCAAGG - Intronic
1014066714 6:117135483-117135505 CAGCAGCATCAGAATCACCAGGG - Intergenic
1014220514 6:118794479-118794501 TAGCAGACACTGAATGAGCAAGG - Intergenic
1016508401 6:144811564-144811586 TAGCATTAGCAGAATTACCAAGG - Intronic
1017384049 6:153861936-153861958 TGGCAGCAGCAGGCTGAGCATGG - Intergenic
1017898557 6:158701817-158701839 TAGCACCAGCAGAGGAAGCATGG - Intronic
1017995971 6:159531960-159531982 GAGCAGCAGCAGAAGGAGAAGGG - Intergenic
1018166079 6:161098317-161098339 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1018896105 6:168018712-168018734 TAGCTGAAGGAGGATGAGCAGGG - Intronic
1019922174 7:4169904-4169926 TAGGGTCAGCAGAATGACCATGG + Intronic
1020641516 7:10759800-10759822 TAGCAGAAACAGTATGAACATGG - Intergenic
1020963249 7:14832771-14832793 TAGTGGAAGCAGATTGAGCAAGG - Intronic
1021514929 7:21473814-21473836 TATCAGGTGCAGAGTGAGCAAGG + Intronic
1021937000 7:25640796-25640818 AAGCAGCTGAAGAATGAGGAAGG - Intergenic
1022073126 7:26937467-26937489 CAGAAGCAGCAGAATGGTCATGG + Intronic
1022480195 7:30738612-30738634 CAGCAGCAGCAGCATCACCAGGG - Intronic
1023835712 7:44066086-44066108 CAGCAGCAGCAGAATGGGCAAGG + Intronic
1025249584 7:57343024-57343046 TGGCTGCAGCAGAATGAGTGAGG - Intergenic
1027798866 7:82726604-82726626 TGGCCACAGCAGAGTGAGCAAGG + Intergenic
1029467777 7:100736944-100736966 GAGCAGCAGCAGCCTGAGCTGGG - Exonic
1029665571 7:101992948-101992970 GACCAGCAGCAGAATGACCAGGG - Intronic
1030182099 7:106720936-106720958 AAGCAGCACCAGAAGAAGCAAGG + Intergenic
1031528845 7:122852685-122852707 TAGCTGGAGCAGAGAGAGCAAGG + Intronic
1031875034 7:127130071-127130093 TGGCAGCAGGAGACAGAGCAGGG - Intronic
1031875881 7:127140543-127140565 TAACAGCACCAGAATGAGAAGGG - Intronic
1032001409 7:128267838-128267860 TGGCAGCCCAAGAATGAGCATGG - Intergenic
1032424709 7:131813131-131813153 TAGCTGCAACAGAAATAGCATGG + Intergenic
1033539107 7:142339373-142339395 TAGAAGCAGCAGAAAGTGCCTGG - Intergenic
1034800485 7:154052685-154052707 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
1034867770 7:154656456-154656478 CAGCAGCCGCAGCATGTGCAGGG + Intronic
1036497510 8:9282889-9282911 AAGCATCAGCAAAGTGAGCAGGG + Intergenic
1037292523 8:17366439-17366461 CAGCATCAGCAGAATGGGAAGGG + Intronic
1037292659 8:17367836-17367858 TAGCATCAGCAGAATGCGAAGGG - Intronic
1038679678 8:29655197-29655219 TTTCAGCAGAAGAATGAGCTGGG - Intergenic
1038706767 8:29901594-29901616 TAGCAGGAACAGAATGAGATGGG - Intergenic
1041182577 8:55264063-55264085 TAGCAGCAGTAAGATGAGCAAGG - Intronic
1041804581 8:61836442-61836464 TGGCAGCAGTAGACTGAGCAGGG + Intergenic
1042229579 8:66542452-66542474 TAGCAGCAGCAGCAGGTCCACGG + Intergenic
1044576287 8:93773268-93773290 TGGCTGGAGCAGAGTGAGCAGGG + Intronic
1045152969 8:99429956-99429978 TGGCTTCAGCAGAGTGAGCAAGG - Intronic
1045425420 8:102061181-102061203 GACCATCTGCAGAATGAGCAGGG + Intronic
1046030900 8:108782949-108782971 TAAGAGCAGCATGATGAGCAAGG - Intronic
1047171062 8:122492626-122492648 TGGCTGCAGCAGAGTTAGCAAGG + Intergenic
1047412420 8:124634770-124634792 CAGCAGCAGCAGAATCACCTGGG + Intronic
1048274468 8:133055852-133055874 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1048752629 8:137697379-137697401 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1049251963 8:141594015-141594037 TAGCTGGAGCAGAGTGAGCCAGG + Intergenic
1049852393 8:144839916-144839938 GAGCAGCGGCAGAGAGAGCAGGG - Intronic
1049864072 8:144922299-144922321 TGGCAGCACCAGAGTGGGCAGGG + Intergenic
1049930909 9:455589-455611 TAGCAGCAGCAGCATCACCTGGG - Intronic
1050928471 9:11296460-11296482 TAGCAGCAGCAACAGCAGCACGG + Intergenic
1051196244 9:14565347-14565369 TGGCTGCAGCAGAATCACCAGGG + Intergenic
1051637350 9:19192953-19192975 TAGCAGCAGCAGAAGGGCCCAGG - Intergenic
1051674701 9:19547308-19547330 CAGCACCTGCAGAATGGGCAGGG - Intronic
1051729920 9:20130545-20130567 TAGCTGAAGCAGAATTAGGAAGG + Intergenic
1052030109 9:23618936-23618958 TTGCTGGAGCAGAGTGAGCAGGG - Intergenic
1053305379 9:36980980-36981002 TGGCAGGAGCAGAATAAGCGGGG - Intronic
1054776757 9:69130534-69130556 CAGCAGCAGCAGCATGACCTGGG - Intronic
1055054136 9:72008105-72008127 GAGGAGCAGCAGGACGAGCATGG - Intergenic
1055948848 9:81712226-81712248 AAGCAGCATCAGAATGTACAAGG - Intergenic
1056711379 9:88994514-88994536 AAGCAGCAGCAGAATGGAGAAGG + Exonic
1057715200 9:97488248-97488270 GAGCAGCAGCAAAGTGATCAGGG - Intronic
1057971278 9:99560500-99560522 TGGCTGCAGCATAATGAGCTGGG + Intergenic
1058345843 9:103960813-103960835 TAGGAGCAGAAGGAAGAGCAAGG + Intergenic
1060745497 9:126128219-126128241 TAGCAGCAAGAGAGTGAGAAGGG - Intergenic
1060951791 9:127608631-127608653 TAGCAGCCGCAGGATGCGCGGGG - Intergenic
1060970883 9:127737192-127737214 CAGCAGCAGCAGAGTGGGAAAGG - Intergenic
1062164027 9:135096665-135096687 CAGCAGCTGCAGAATGACAAGGG - Intronic
1185480223 X:440743-440765 CAGCAGCAGCAGCCTGAGGAAGG - Intergenic
1186470343 X:9816579-9816601 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1187778066 X:22786229-22786251 TTGAAGCAGGACAATGAGCATGG - Intergenic
1187966213 X:24614941-24614963 TAGCAGCAGCAGCATCACCTGGG + Intronic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1189105791 X:38233903-38233925 AAGCAGCAACAGAATCAGTAAGG - Intronic
1189186752 X:39061532-39061554 TAGCAGCTGTCGAGTGAGCAAGG - Intergenic
1189715500 X:43860794-43860816 TGGCTGTAGTAGAATGAGCAAGG - Intronic
1190237924 X:48631671-48631693 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1190324215 X:49196756-49196778 TAGGTGCACAAGAATGAGCACGG - Intronic
1191075144 X:56445032-56445054 TGCCAGCAGCAGAGGGAGCATGG + Intergenic
1191666239 X:63705718-63705740 CAGCAGCATCAGAATCACCAGGG + Intronic
1192034134 X:67545408-67545430 CAGCAGCAGCAGGGTGAGGATGG + Exonic
1192298837 X:69879539-69879561 TGGCAGCATCAGCATTAGCAGGG - Intronic
1193679853 X:84504878-84504900 TAGCTACAGCATAATGAGCCAGG - Intergenic
1194300836 X:92183705-92183727 TGGCAGGAACAGAATGATCAAGG - Intronic
1196047370 X:111270388-111270410 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1196086299 X:111685911-111685933 TTGCAGGAGCATAGTGAGCAAGG + Intronic
1197687630 X:129458754-129458776 CAAAAGCAGCTGAATGAGCAAGG + Intronic
1198415804 X:136418600-136418622 CAGCAGCAGCAGAACAATCAAGG - Intergenic
1198840982 X:140857927-140857949 TAGGACCAGGAGAATGTGCAGGG - Intergenic
1199222569 X:145334337-145334359 TAGCTGCAGCAGACTAAGTAAGG + Intergenic
1199788686 X:151129451-151129473 AAGCAGCAGCAGAATTTGAAAGG - Intergenic
1200980390 Y:9258642-9258664 CAGCAACAGCCCAATGAGCAAGG - Intergenic
1201239636 Y:11946353-11946375 TAGCTTCAGCAGAACAAGCACGG + Intergenic
1201300219 Y:12498670-12498692 AAGCAGCAGCAGGAGGAGGAGGG - Intergenic