ID: 1114860788

View in Genome Browser
Species Human (GRCh38)
Location 14:26518415-26518437
Sequence AAGGTGTTATTGATAAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 313}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114860788 Original CRISPR AAGGTGTTATTGATAAAAGA GGG (reversed) Intronic
901618360 1:10560359-10560381 AAGCTGTTAAATATAAAAGATGG - Intronic
902526669 1:17063249-17063271 AATGTGTTTTGAATAAAAGAAGG - Intergenic
902961425 1:19965821-19965843 GAGGTGTAAATGATAAAAGAAGG + Intergenic
907299586 1:53478251-53478273 AAGTTGTTATTAAGAAAAGAAGG + Intergenic
907517179 1:55000178-55000200 AAGGTGTTATTTATAGATGAAGG + Intronic
908053750 1:60260544-60260566 AAAGTGATTTTGATAAGAGAAGG + Intergenic
909502882 1:76354903-76354925 AAGCTTTTATTGAAATAAGAGGG + Intronic
911067117 1:93800092-93800114 AATATTTTATTGATAAAGGATGG - Intronic
911226011 1:95306430-95306452 CAGGTGTTCTTGAAAAAAGAAGG + Intergenic
911831687 1:102557544-102557566 AACATGTTTTTAATAAAAGAAGG + Intergenic
911975015 1:104481191-104481213 AAGGTGTTATAGATGCAAAATGG - Intergenic
911980681 1:104561500-104561522 AACATGTTTTTAATAAAAGAAGG - Intergenic
912091140 1:106078097-106078119 AAGGTGTTCTGGAGGAAAGATGG + Intergenic
912761153 1:112368595-112368617 AATGTGTTATTGAAACAAAAAGG + Intergenic
912956723 1:114159143-114159165 ATGGTGTCATTGATAAAATACGG + Intergenic
913373394 1:118125733-118125755 AATGTGTTATTTATACAAAATGG - Intronic
914745278 1:150496971-150496993 AAGGTGTTTGTGTTAAAAGATGG + Intronic
915271091 1:154754004-154754026 AAGGTTTTATTGCTCACAGAAGG - Intronic
915667390 1:157457577-157457599 AACATGTTTTTAATAAAAGAAGG + Intergenic
916160060 1:161902201-161902223 AAAGTGGTATTGAAAAAAGTGGG + Intronic
916597197 1:166255669-166255691 AAGCTGTCCTTCATAAAAGAAGG - Intergenic
916833393 1:168515963-168515985 AAGGTCTTTTTGATATAAAAAGG + Intergenic
917049987 1:170911069-170911091 AAGGTGCTATTGATTAAAATGGG + Intergenic
917381838 1:174419585-174419607 AATTTGTTATTGTAAAAAGATGG + Intronic
917392612 1:174555739-174555761 AAGATGATTTTGATAAAGGAAGG + Intronic
918768739 1:188523965-188523987 AACGTGTTTTTAACAAAAGAAGG - Intergenic
918790535 1:188821439-188821461 GAGATTTTATTAATAAAAGAGGG + Intergenic
919242087 1:194926605-194926627 AACGTGTTTTTAACAAAAGAAGG - Intergenic
919442457 1:197654189-197654211 AATGTGTTATTAATAAATTAAGG - Intronic
921371733 1:214430548-214430570 AAGGTCTTACAGAGAAAAGATGG + Intronic
921519556 1:216142947-216142969 GAGGTGTTATGGAGAGAAGAGGG - Intronic
923380154 1:233409269-233409291 AAGGCGTTAAAGATAAAAAAAGG - Intergenic
924391273 1:243561832-243561854 AAGATGTTATTTTTCAAAGATGG + Intronic
1063505880 10:6599200-6599222 AAAGTATAAATGATAAAAGAGGG - Intergenic
1063727749 10:8657053-8657075 AATGTATTTTTTATAAAAGAAGG - Intergenic
1066169824 10:32829410-32829432 AATGTGTTTTTAACAAAAGAAGG - Intronic
1066538688 10:36420566-36420588 AAGATTTTATTTATAAAAGCAGG - Intergenic
1066978113 10:42387776-42387798 TTGGTGTTCTGGATAAAAGAAGG + Intergenic
1068287917 10:54963281-54963303 AAGGTGTCAGTGGCAAAAGAAGG + Intronic
1068595033 10:58893871-58893893 AAAGTGTTTTTGTTAAAAGTAGG - Intergenic
1069516749 10:69083644-69083666 AAGGTGTTACAGAAAAAAAAAGG - Intergenic
1070360540 10:75684360-75684382 ATGGTGTTATTGGGAAAAGAAGG - Intronic
1071128502 10:82364274-82364296 AATGAATTATTAATAAAAGAAGG - Intronic
1072102534 10:92242884-92242906 AAGGTCTTATTTATTAAAGGTGG - Intronic
1072279664 10:93854295-93854317 AAGGATTTATAGATAAAAAAAGG - Intergenic
1074253634 10:111778660-111778682 AGGGTGTTATGGAAAACAGAAGG - Intergenic
1077843561 11:6000663-6000685 ATGGTGATAATGGTAAAAGAAGG + Intergenic
1078080004 11:8197283-8197305 AAGTTGTTATTGATAGAGAAGGG - Intergenic
1078461519 11:11518768-11518790 AAAGTGTTAGTCATAGAAGATGG + Intronic
1079047332 11:17117443-17117465 AATGTGTTAATGTTAAAGGAAGG - Intronic
1081056438 11:38415463-38415485 AAGCTGGTGTTGAAAAAAGAGGG - Intergenic
1083518229 11:63280964-63280986 AGGTTGTTATTGATATATGAGGG + Intronic
1085466247 11:76725518-76725540 TAGGTGCTATTAAAAAAAGAAGG + Intergenic
1085869479 11:80332491-80332513 AGGGTGTTTTTGATGAAGGAAGG + Intergenic
1087917761 11:103830671-103830693 AGTGAGTTCTTGATAAAAGAAGG + Intergenic
1090991599 11:131822003-131822025 GAGCTTTTATTGATAAAGGAAGG - Intronic
1093119558 12:15252301-15252323 AATGTGATATTTATAAAAAATGG + Intronic
1093645991 12:21585715-21585737 AAGGTGTTTTTAACAAAAGAAGG - Intronic
1093685318 12:22047307-22047329 CTGATGTTATTCATAAAAGAAGG + Intronic
1095198961 12:39359748-39359770 AAGGTGTTGTGGGTCAAAGAAGG - Intronic
1095277940 12:40311802-40311824 AAGGTTTTATTGATGATAGATGG + Intronic
1095675785 12:44916567-44916589 AAGGTGTGATGGAGTAAAGATGG - Intronic
1095855973 12:46861615-46861637 AACATGTTTTTGACAAAAGAAGG + Intergenic
1098114447 12:67160322-67160344 AATGTGTCATTGCTGAAAGAGGG + Intergenic
1098646617 12:72909901-72909923 AAGGTGTTATAGAGAAAAATTGG + Intergenic
1099252830 12:80279149-80279171 CAGGTGTTTTTGATAAAGGTAGG + Exonic
1100060840 12:90574140-90574162 AAGGTGTTAAGGATAAAGAAAGG - Intergenic
1103778653 12:123384533-123384555 TAGGTGTTATTGATAGAAGTGGG + Intronic
1106769147 13:32944926-32944948 AAGGTGCTATGGGTAAAACAGGG + Intergenic
1106974907 13:35198743-35198765 GAGGTGATATTGATGAAAGGAGG + Intronic
1108104096 13:46990096-46990118 ATGGTATTATTGATAGAAGGTGG - Intergenic
1108422867 13:50268359-50268381 AAGCTGTTATTAATAGAACATGG - Intronic
1108703102 13:52960297-52960319 AAGGTCTTAATGAAAAGAGAGGG + Intergenic
1108706255 13:52990920-52990942 ACGGTGTCATTGATTAAAGATGG + Intergenic
1109104317 13:58230863-58230885 AATTTATTATTGATAAAAGTAGG + Intergenic
1110054444 13:70947838-70947860 AAGGAATTATTGATAAAAAATGG - Intergenic
1110466895 13:75812668-75812690 AAGGTGTCAATCATAAAACAAGG - Intronic
1111088726 13:83413321-83413343 AAGTAGTTATTAATAAAAGAAGG + Intergenic
1112636477 13:101223009-101223031 TTGGTGTTCTGGATAAAAGAAGG - Intronic
1113050743 13:106208965-106208987 AGGGAGTTATTGGTAAAAGAAGG - Intergenic
1113282755 13:108808318-108808340 AAGGTTCTATTAAAAAAAGAAGG - Intronic
1114486630 14:23066665-23066687 AAGGTGTCTTTGATAAAGGAAGG + Intronic
1114860788 14:26518415-26518437 AAGGTGTTATTGATAAAAGAGGG - Intronic
1115141045 14:30171046-30171068 AAGGTGTGATGGAGTAAAGATGG - Intronic
1116279164 14:42879966-42879988 AGGGTGTTGTTGAGAACAGAGGG - Intergenic
1118685014 14:68282565-68282587 AAGGTGTTATTTTTAAAAGGAGG - Intronic
1118913559 14:70081947-70081969 AAGCTGTTATTTATAAGGGAGGG - Intronic
1119272301 14:73318284-73318306 AAGATGTTAATGAAAAAAGTTGG + Intronic
1119899855 14:78250463-78250485 AAGGTGGTAGAGATAAAAGGAGG + Intronic
1121784572 14:96647487-96647509 AAGTTGTCATTCATAAATGAAGG - Intergenic
1121851680 14:97227209-97227231 AAGGTGAGATGCATAAAAGAAGG - Intergenic
1121933059 14:97990886-97990908 AAGGGGTTATGGTTACAAGATGG + Intergenic
1122066855 14:99179800-99179822 AATGTTTTATTAAAAAAAGAAGG - Intronic
1125033895 15:35101503-35101525 GAGGTGATATTGACAAAAGTGGG + Intergenic
1125992372 15:44122200-44122222 AAACTGTTAATGGTAAAAGAAGG + Intronic
1128654032 15:69446007-69446029 AGGGTGATATTTATAAAACAAGG + Exonic
1132137970 15:99362560-99362582 AAGCTGTCATTAATAAAAGCAGG - Intronic
1133137929 16:3725074-3725096 ATGGTGTTTATAATAAAAGATGG - Exonic
1133551403 16:6858197-6858219 AAAGTGTTGTTGGTAAACGAAGG + Intronic
1134317387 16:13131639-13131661 AAGGTTTTATTTACAAAAGCAGG + Intronic
1135198747 16:20418439-20418461 ATGATGTAATTGATAAAAGCAGG + Intronic
1136184555 16:28579147-28579169 AAGGTATATTTGATAAAATAAGG - Intronic
1139137231 16:64219676-64219698 TAGGTGTTGTTGGTAAAAGCAGG + Intergenic
1139539735 16:67605701-67605723 AATGTGTTTCTGATAAAATAAGG - Intronic
1140082492 16:71762001-71762023 AAAGTGAAATTGATAAAACAGGG - Intronic
1140322609 16:73967992-73968014 GAGGTGTTATTTTTAAAAAAAGG + Intergenic
1140942443 16:79734599-79734621 AAGGAGTTACTGAAAAAAAATGG - Intergenic
1144497745 17:15759275-15759297 AAGGTGTATTTGAAGAAAGAGGG - Intergenic
1144629543 17:16863763-16863785 AAGGTGTATTTGAAGAAAGAGGG - Intergenic
1146758710 17:35456201-35456223 AACATGTTTTTAATAAAAGAAGG - Intergenic
1148000892 17:44386240-44386262 GAGGTGTCATTGAGGAAAGATGG - Intronic
1149037164 17:52147851-52147873 AAGGGGTTATAGAAAAAAAAGGG - Intronic
1150261494 17:63795789-63795811 AAGTTGTTATAAATCAAAGATGG - Intronic
1150801246 17:68284545-68284567 AAGGTTTTATTGAAAGTAGAAGG + Intronic
1152096796 17:78277382-78277404 AAGGTTTTTTTAAAAAAAGAGGG + Intergenic
1153090002 18:1332223-1332245 AACATGTTTTTAATAAAAGAAGG - Intergenic
1154492008 18:14929829-14929851 TAGGTGTAATAGATAAACGAAGG + Intergenic
1155840881 18:30641065-30641087 AAGGTTTTAGTGTTAAAATAAGG - Intergenic
1155932722 18:31724156-31724178 AAGGTGTAGTTAATAAAGGACGG + Intergenic
1156250491 18:35347545-35347567 AAGATGGTAATGTTAAAAGAAGG - Intergenic
1157884499 18:51353376-51353398 AAGATGTAATAGATCAAAGATGG - Intergenic
1158048378 18:53185139-53185161 CAGGTGTTATAAATAAGAGATGG + Intronic
1158329046 18:56341233-56341255 AAGGTATAATTGAAAGAAGATGG + Intergenic
1158655324 18:59325576-59325598 AAGGTGTTACTAATAGGAGATGG + Intergenic
1159422321 18:68238242-68238264 AAGTTGTTAATGAAAAAAAATGG + Intergenic
1159768341 18:72518105-72518127 AAGCTATTATTTGTAAAAGAGGG - Intergenic
1162247506 19:9414412-9414434 AAGGTGTGAATGATTAATGAAGG + Exonic
1162253554 19:9468026-9468048 AAGGTATGACTGATAAATGAAGG + Exonic
1164738106 19:30557022-30557044 AAAGTGTTATTTATAAAATTTGG - Intronic
1164839262 19:31380377-31380399 AAGGTGTTGTTAACAGAAGAAGG - Intergenic
1164954796 19:32373024-32373046 AAGGTGTTATTTATGAAGCAGGG - Intronic
1165622125 19:37256910-37256932 AAGGAGTTTTTGAGCAAAGAGGG + Intergenic
1168539051 19:57195347-57195369 AACATGTTTTTAATAAAAGAAGG + Intronic
925260034 2:2520930-2520952 CAGGTGGTATTGATAAAACAGGG - Intergenic
925946237 2:8866381-8866403 AAGGTGTTAATAATAAACAAAGG + Intronic
926497651 2:13611422-13611444 ATGGTGTTATTGAAAAAGGTGGG + Intergenic
926543933 2:14215395-14215417 AAGGTGTAATTCACAAAAGGGGG - Intergenic
931570452 2:63663619-63663641 TAGGTGTGATTTATAAAAGTTGG + Intronic
931613344 2:64127657-64127679 AAGGTCTTGTTGGTAATAGAGGG - Intronic
931954652 2:67407725-67407747 AAAGTGTTATTAAGAAAATAAGG + Intronic
932043215 2:68320880-68320902 AAACTGTTAATGATAAAAGTGGG + Intergenic
932562262 2:72883620-72883642 AAGGTGTATTTGATAAAGGATGG - Intergenic
935319615 2:101873080-101873102 AAGGTGCAAATGACAAAAGAAGG - Intronic
935737426 2:106117561-106117583 AAGGTTCTATTGATAGAAGGTGG + Intronic
937343802 2:121110126-121110148 AAGGTATTCTTTATAAGAGAAGG + Intergenic
937721665 2:125104003-125104025 AGGGTGGTATTGACAAAAGAAGG - Intergenic
938688666 2:133765957-133765979 AAAATGCTATTGACAAAAGATGG - Intergenic
941112524 2:161430823-161430845 AACCTTTTGTTGATAAAAGATGG - Intronic
941580072 2:167285124-167285146 AAAGAGTTTTTGAAAAAAGAAGG + Intergenic
941609547 2:167644264-167644286 AAGGTGTTCTGGATGAGAGAAGG + Intergenic
941668310 2:168263160-168263182 AACATGTTTTTAATAAAAGAAGG - Intergenic
942058518 2:172206943-172206965 AATGTGATATTATTAAAAGATGG - Intergenic
943329370 2:186540479-186540501 AAGAAGTTATTTAGAAAAGAAGG - Intergenic
943506366 2:188764553-188764575 AAGATGTTATTGACCAAATAGGG - Intronic
943593327 2:189825706-189825728 TGGATGTCATTGATAAAAGAAGG + Intronic
945063885 2:205931966-205931988 AAGGCCTTACTGATAAAACAGGG + Intergenic
945744154 2:213700387-213700409 TAGGTGTTATTTATAAGAGGTGG + Intronic
945755188 2:213837129-213837151 AATATGGTATTCATAAAAGAGGG - Intronic
946086514 2:217178918-217178940 AAGGTGTGTTTGATAAAACTGGG - Intergenic
946425594 2:219594076-219594098 AAAGTGCTGATGATAAAAGAGGG - Intergenic
946691787 2:222313776-222313798 AATGTGTTATTTATATATGATGG + Intergenic
946837547 2:223787432-223787454 AAGGTGTTCTTGAGTTAAGAAGG + Intronic
948184722 2:236011959-236011981 AAGGTGTTATTGATGATAATAGG + Intronic
1168825069 20:805642-805664 AATGTGTTCTTGTTAAAAGGAGG + Intergenic
1169696437 20:8392512-8392534 AAGGTGAGATTCCTAAAAGATGG - Intronic
1170473294 20:16689484-16689506 TATGTATTATTAATAAAAGATGG - Intergenic
1170765983 20:19290383-19290405 AAGGTGATAGTGTTAGAAGATGG + Intronic
1170772486 20:19345526-19345548 AATGTGGTATTGGTAAAAGAAGG + Intronic
1173030573 20:39355456-39355478 GAGGTATAATTGATAAAAAAAGG - Intergenic
1174895372 20:54443716-54443738 AATACATTATTGATAAAAGAAGG + Intergenic
1175602146 20:60283275-60283297 AAGGGGTTATTTATTAAAAAAGG + Intergenic
1175637235 20:60596024-60596046 AAGGTGTTATTGATAATATGTGG - Intergenic
1176013710 20:62916192-62916214 AAGTTGTTACTGATACAATATGG - Intronic
1177397092 21:20550538-20550560 ATGTTTTTATTGATAAAAGGTGG - Intergenic
1177550366 21:22612899-22612921 AAGGTGGTCATGATAAGAGAAGG + Intergenic
1178268390 21:31166672-31166694 AAGGTGGTAGTGGTCAAAGAAGG + Intronic
1181280105 22:21713784-21713806 AAGGTCTCATTAACAAAAGAAGG + Intronic
1185236016 22:49713507-49713529 AAGGTGTCTTTGATAACACAGGG - Intergenic
949122083 3:398359-398381 AAGATGTAATTGAGACAAGAGGG + Exonic
950730158 3:14948981-14949003 ATGGTGTTATTGTTAAAAATGGG + Intronic
951847536 3:27100837-27100859 AATGTGTGACTGATCAAAGATGG + Intergenic
951941128 3:28079933-28079955 AAAGTGTGAATGATAAATGAAGG - Intergenic
952650275 3:35718468-35718490 AGGGTGATATAGATAAAACATGG + Intronic
953081791 3:39627251-39627273 AAGTTATTATTGATATGAGAGGG - Intergenic
953427858 3:42810482-42810504 AAGTTGGTATTGATAAAACGTGG - Intronic
953707236 3:45240546-45240568 GATGTGTCATTGATAAAACAAGG + Intergenic
953753236 3:45625425-45625447 AAGGTGTTCTAGGTAAATGAAGG - Intronic
957256978 3:77849776-77849798 AACATGATAATGATAAAAGAAGG + Intergenic
957307503 3:78476944-78476966 AAGGTCTTGTTTATATAAGAAGG + Intergenic
957322046 3:78643795-78643817 AAGGTATTATAGATAAAGGTAGG + Intronic
957494846 3:80979126-80979148 AATGTATTATTGTTAAAATATGG - Intergenic
958789642 3:98636372-98636394 AAGGTATTCTTCATAAATGAAGG + Intergenic
959800037 3:110482523-110482545 AATGTGTTATTTAAATAAGAAGG - Intergenic
960128920 3:114032219-114032241 CAGGTGTTATTGAATAAGGAGGG + Intronic
960245440 3:115394976-115394998 ATGGTGTTATGGAGAAAACACGG + Intergenic
961263333 3:125620177-125620199 AAGGTGTGATTGAAAAACCAGGG + Intergenic
962168170 3:133072630-133072652 AAGCTGTTATTTTAAAAAGAAGG - Intronic
962663045 3:137624583-137624605 AAGGAGTCAGTGATAAAGGAGGG - Intergenic
962823354 3:139074659-139074681 AAGTTATTATTCATAAATGAAGG + Intronic
963432811 3:145231018-145231040 AATGTGTGAGTGATAAAAGTTGG + Intergenic
963586681 3:147200247-147200269 TGGGTGTTATTTATAAAAGTTGG - Intergenic
964217540 3:154303328-154303350 AAGATGTAATTGAAAAAATAAGG - Exonic
966265165 3:178031625-178031647 AAGGGGTTGTTGGTAAAAGCAGG + Intergenic
966286800 3:178306637-178306659 AATGTGATATGGCTAAAAGAAGG - Intergenic
967676233 3:192301946-192301968 AAGGTGTAAGAGAGAAAAGATGG - Intronic
970164949 4:13226697-13226719 AACATGTTTTTAATAAAAGAAGG - Intergenic
970554989 4:17222271-17222293 AATGAGTTATTGAATAAAGAAGG + Intergenic
971322179 4:25614546-25614568 AATGTGTTAGTGATAACATAGGG + Intergenic
971737092 4:30467475-30467497 AAGTAGTCATTGATAAATGATGG + Intergenic
972085490 4:35209188-35209210 AATATGTTTTTAATAAAAGAAGG - Intergenic
972113205 4:35592360-35592382 AAGGAGTTTGTGATAAAGGAAGG + Intergenic
972430798 4:38979626-38979648 AAAGTGTGATGGAGAAAAGAAGG - Intronic
972878743 4:43397133-43397155 ATGGTGTAAAAGATAAAAGATGG - Intergenic
973736514 4:53877039-53877061 AAGGAGTTATAGCTAAAACAAGG - Intronic
973886171 4:55324318-55324340 AAGATGTTATTGATAGATCATGG - Intergenic
974345751 4:60679142-60679164 AATGTGATATTGTTAAGAGATGG + Intergenic
974485357 4:62497086-62497108 AACTTCTTATTGATAAAATATGG - Intergenic
974738452 4:65972645-65972667 AAGCTGTTATTTACAAAATATGG - Intergenic
974976408 4:68898710-68898732 AATGTCTTCTTTATAAAAGAGGG - Intergenic
975223952 4:71847591-71847613 GAAGTGTTATGGTTAAAAGATGG - Intergenic
975635926 4:76448179-76448201 AAGAGGTTTTTCATAAAAGATGG + Intronic
976339569 4:83932088-83932110 AAATTGTTATTGATAAATGTTGG - Intergenic
976690359 4:87862211-87862233 GACGTGTTATTGCAAAAAGAAGG - Intergenic
976923747 4:90470975-90470997 TTGGTGATATTGATAAAAGAAGG + Intronic
977653989 4:99501053-99501075 AAGGTGATCATGTTAAAAGATGG - Intergenic
978182615 4:105818291-105818313 AAATTGTTATTGACAAAAGTAGG + Intronic
978972486 4:114826917-114826939 AAAGCTTTATTGATAAAATATGG - Intergenic
979120831 4:116898324-116898346 AAGAAGTTATTTAAAAAAGAAGG + Intergenic
979123441 4:116933091-116933113 AAGAAGTTAATGATAAAACAGGG + Intergenic
979372123 4:119901540-119901562 AAGATGTTATAGGTAAAGGAAGG - Intergenic
979534332 4:121802375-121802397 AAGTATTTATTGATACAAGATGG - Intronic
979821015 4:125172011-125172033 TGAGTGTTATTGATAAAAGAGGG + Intergenic
980656843 4:135799596-135799618 TAGGTGTTACTCAGAAAAGAGGG - Intergenic
982815898 4:159884041-159884063 AAGGTGTTGATAATAAAAGGCGG - Intergenic
982849317 4:160292815-160292837 AAGGTTTTATTGATTGAAAAAGG + Intergenic
984112408 4:175634563-175634585 AAGGTGTTATGTATAACACATGG + Exonic
987397909 5:17443203-17443225 CAGATGTTATTGATAAGGGAGGG + Intergenic
987661873 5:20888612-20888634 AAAATGTTATTGATAATAAAAGG - Intergenic
988761713 5:34316707-34316729 AAAATGTTATTGATAATAAAAGG + Intergenic
989275689 5:39586121-39586143 AAGGTCTTATTGATACAGGAGGG + Intergenic
989720299 5:44520179-44520201 AAGGCTTTAATGAAAAAAGAAGG - Intergenic
990050316 5:51491985-51492007 AAGTTGTAATTCATAAATGAGGG - Intergenic
991946428 5:71902190-71902212 AAGATGTTTTTAACAAAAGAAGG - Intergenic
993772043 5:91940372-91940394 AAGGTGTTATTTAAGAAAGCTGG - Intergenic
994750453 5:103731308-103731330 GAGGTGTTATTTATAAAATGTGG + Intergenic
994771010 5:103981612-103981634 AAGGTGATAGTGTTAGAAGATGG + Intergenic
995024882 5:107408797-107408819 AAGGAGGAATCGATAAAAGATGG - Intronic
998064260 5:139144532-139144554 AAAGTGTTATTGAGTAAAAAGGG + Intronic
998570474 5:143252280-143252302 GAGGTGGTATTGCTAGAAGAAGG + Intergenic
998608658 5:143663919-143663941 CAGATGATACTGATAAAAGAAGG - Intergenic
999070571 5:148739493-148739515 ACGGTATTCTTGATAAAATAGGG + Intergenic
999105736 5:149069465-149069487 AAAGTGTTATGGAAAAAAAAAGG + Intergenic
1000675332 5:164115202-164115224 AAAGATTTATTGATAAAAGTAGG - Intergenic
1000740588 5:164964909-164964931 AAGGTGCTTTTGAAAAATGAGGG + Intergenic
1002552390 5:180005020-180005042 AAGATGATATTAATAAAATAAGG - Intronic
1002553309 5:180014573-180014595 AATGTGTTATTCATTGAAGAAGG - Intronic
1003621438 6:7704541-7704563 AAGGTGATAATATTAAAAGATGG + Intergenic
1004438263 6:15618858-15618880 AATGTGTTATATATAAACGATGG + Intronic
1006001826 6:30971131-30971153 AACGTGTTTTTAACAAAAGAAGG - Intergenic
1006409544 6:33864544-33864566 AAGGTATTATTAAAAAAAAAAGG - Intergenic
1007672048 6:43563749-43563771 ATGGTATAAATGATAAAAGATGG + Intronic
1008924720 6:56879634-56879656 AAGGAGTGAATGATATAAGATGG - Intronic
1009336890 6:62502221-62502243 AAGGTGATAATGTTAAGAGAAGG + Intergenic
1009930882 6:70176386-70176408 TAAGTGTTATTGATATTAGATGG - Intronic
1010333343 6:74650412-74650434 AATGTGTTATTGATATACAATGG - Intergenic
1010638303 6:78287658-78287680 AAGGTGAAATTGAGAAAAGGTGG - Intergenic
1010663741 6:78601356-78601378 GAGGTGTCATTGAGAATAGATGG + Intergenic
1011863146 6:91786067-91786089 GAGGTGTTATTGGTATAAGTGGG + Intergenic
1011910700 6:92433836-92433858 TAGGTACTATTGATAAATGATGG - Intergenic
1014897197 6:126916720-126916742 GAAGTGTTATTGTTAGAAGAAGG + Intergenic
1014957287 6:127636426-127636448 AAGGTGGTTTGGAGAAAAGAAGG - Intergenic
1015360987 6:132339217-132339239 AAGTTGCCTTTGATAAAAGAGGG - Intronic
1015648063 6:135417712-135417734 AAGGTGTTAAAGATAAAATAGGG - Intronic
1017250685 6:152276717-152276739 AAGGTGTAAATGGTAAAGGAAGG + Intronic
1017320063 6:153080489-153080511 TAGAGATTATTGATAAAAGATGG - Intronic
1019908483 7:4082994-4083016 ACGGTGGTTTTGATAAAAGTAGG + Intronic
1021872874 7:25020295-25020317 AAGGTGATAATGATAAAATAAGG + Intergenic
1022079176 7:27002408-27002430 AACATGTTTTTAATAAAAGAAGG - Intergenic
1022553811 7:31271260-31271282 TAGGTGGTATTGTTAACAGAGGG + Intergenic
1022859378 7:34351399-34351421 GAGGTTTTATTGGAAAAAGAGGG + Intergenic
1022864223 7:34400480-34400502 AAGTTGTCATGGATTAAAGATGG - Intergenic
1023145066 7:37142958-37142980 GGGGTGTGATTGATAAAAGGAGG - Intronic
1025718475 7:63986207-63986229 ATGTTGTTATTGATAAGTGAAGG - Intergenic
1026469438 7:70682289-70682311 AATCTGTTTTGGATAAAAGAAGG + Intronic
1026645791 7:72167080-72167102 AAGCAGTTAATAATAAAAGAAGG + Intronic
1027376179 7:77552568-77552590 AACAGGTTATAGATAAAAGAGGG + Intronic
1027643769 7:80770602-80770624 AGGGTGTTAGTGCCAAAAGAAGG - Intronic
1027645974 7:80798798-80798820 GAGGTGTCATTGACTAAAGATGG - Intronic
1028695036 7:93699422-93699444 AAGGTGGGATTGATAAAGGATGG + Intronic
1028866032 7:95714044-95714066 AGGGTGTTATTTTTAAAAAAAGG + Intergenic
1029164722 7:98579571-98579593 AAGGATTTAGTGATAAAGGAAGG + Intergenic
1030355696 7:108539588-108539610 AACGTGTTTTTAACAAAAGAAGG - Intronic
1031188959 7:118521544-118521566 AACGTGTTATAGATACATGATGG - Intergenic
1031383618 7:121118758-121118780 AAGCTTTTACTGATAAGAGAAGG + Intronic
1031402668 7:121344432-121344454 AAGGTGTTATTTTTAACAGATGG + Intergenic
1032593970 7:133220432-133220454 TACGTGTTATTGAAAAATGAAGG + Intergenic
1032891833 7:136204642-136204664 AAGATGTTATAAATAAAATATGG - Intergenic
1033555329 7:142484035-142484057 AAGCTGTTGTTGTTAGAAGAGGG + Intergenic
1034026093 7:147706369-147706391 AAGTTGTCATTCATAAATGAAGG - Intronic
1034963803 7:155378914-155378936 AAGGTTTTATAGCTTAAAGATGG + Intergenic
1034981064 7:155476986-155477008 AAGGTGTTACTGCCAAAAGAGGG + Intronic
1037052806 8:14397878-14397900 AAGGTTGTCTTGATGAAAGAAGG - Intronic
1037257695 8:16973658-16973680 AAAATTTTATTGATAAAAGAAGG + Intergenic
1037936402 8:22917662-22917684 AAGGTGTGATTGATCAGATAAGG - Intronic
1039217468 8:35288354-35288376 AAGCTGTTCTTCATAAATGAGGG + Intronic
1040647521 8:49416756-49416778 AAGGTGTGATAGATTGAAGACGG - Intergenic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041734971 8:61100536-61100558 AAGCTGTTTTTGAAAAAAGAAGG - Intronic
1042617363 8:70664548-70664570 AAATTGGAATTGATAAAAGAAGG + Intronic
1042671247 8:71265903-71265925 AAGGTGATAGGGACAAAAGAGGG - Intronic
1042693069 8:71525262-71525284 ACTGTTTTATTGATACAAGATGG + Intronic
1043254325 8:78114726-78114748 AAGCTGTGATTGATCAAAGATGG - Intergenic
1044145125 8:88703583-88703605 AAGGTGTTATAGCTAAAAACTGG + Intergenic
1044683297 8:94802969-94802991 ATGGTGTTTTTAATAAATGATGG - Intergenic
1046188325 8:110753038-110753060 CAGCTGTTACAGATAAAAGAGGG - Intergenic
1047564318 8:126024987-126025009 AAGGGAATAATGATAAAAGAAGG + Intergenic
1048582282 8:135739580-135739602 AAGGTGTTTATCAGAAAAGATGG - Intergenic
1050556961 9:6797868-6797890 GTGGGGTTGTTGATAAAAGAAGG + Intronic
1050837324 9:10098995-10099017 AAGATGATATTGTCAAAAGAGGG - Intronic
1054711488 9:68515521-68515543 AAGGTGATGTTGACAACAGAAGG - Intronic
1056041582 9:82673456-82673478 ATGGTGTAATAGATAAAAAATGG - Intergenic
1056987846 9:91380677-91380699 ATGCTGTTATTCAAAAAAGAAGG + Intergenic
1057048952 9:91907528-91907550 AAGGTGATATTTTTAAAAGGGGG + Intronic
1057821953 9:98339132-98339154 AAGGGGTGATGGATAAAAGAAGG + Intronic
1057865368 9:98675926-98675948 GAGGTTTTATTACTAAAAGAAGG - Intronic
1058605288 9:106715158-106715180 AAGGAGTTAATGAAAAAAGCAGG + Intergenic
1187859121 X:23664947-23664969 TAGGTGTTATTTATAAAATCAGG + Intronic
1188104485 X:26133198-26133220 AAAATGTTATTGAAAACAGAAGG + Intergenic
1188765665 X:34088369-34088391 AAGCTGTCATTGATAAATTAAGG + Intergenic
1188841526 X:35023725-35023747 AAGGTGTTAATGAATGAAGATGG - Intergenic
1189235863 X:39486634-39486656 ATGGTGTTACAGATAAAGGAAGG - Intergenic
1189373495 X:40448347-40448369 AAGGTGGTATGGAGGAAAGATGG - Intergenic
1189804945 X:44726118-44726140 AATGTGTTTTTGAAAAAATAAGG - Intergenic
1189872787 X:45401929-45401951 AATGAGGTATTGATATAAGATGG - Intergenic
1190486871 X:50935682-50935704 AATGTGGTATAGATAAAACAGGG + Intergenic
1190512645 X:51189847-51189869 AAGGTGTTATTAATATGAGAGGG + Intergenic
1193437211 X:81489957-81489979 ATAGTGTTATTGATACAAAAAGG - Intergenic
1193682035 X:84533494-84533516 AAGCTGTTAATTATAAAAAAGGG - Intergenic
1194008913 X:88534225-88534247 AAAGTGTTATTTATGAAACATGG - Intergenic
1194693393 X:97014180-97014202 ATGGGGTTAATGACAAAAGAAGG + Intronic
1194848971 X:98850109-98850131 AACATGTTTTTAATAAAAGAAGG + Intergenic
1196223989 X:113143688-113143710 AAGGTATTAAAAATAAAAGATGG - Intergenic
1196347864 X:114687787-114687809 GAGCTGATATTTATAAAAGAAGG - Intronic
1197692674 X:129520705-129520727 AAAGTGTCAGTGATAAAACAGGG - Intronic
1200945793 Y:8835667-8835689 AAGCTTATATTGATAAAACATGG - Intergenic
1202244176 Y:22800165-22800187 AATGTGTTCTTGATAATACATGG + Intergenic
1202397164 Y:24433915-24433937 AATGTGTTCTTGATAATACATGG + Intergenic
1202473617 Y:25236177-25236199 AATGTGTTCTTGATAATACATGG - Intergenic