ID: 1114867037

View in Genome Browser
Species Human (GRCh38)
Location 14:26608431-26608453
Sequence ACTAGTATGTGAAGCAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114867032_1114867037 -4 Left 1114867032 14:26608412-26608434 CCAAAAATGCCTTCACTGGACTA No data
Right 1114867037 14:26608431-26608453 ACTAGTATGTGAAGCAGGGAGGG No data
1114867028_1114867037 30 Left 1114867028 14:26608378-26608400 CCTGAACCATAATATGAAAGAAA No data
Right 1114867037 14:26608431-26608453 ACTAGTATGTGAAGCAGGGAGGG No data
1114867030_1114867037 3 Left 1114867030 14:26608405-26608427 CCTATGACCAAAAATGCCTTCAC No data
Right 1114867037 14:26608431-26608453 ACTAGTATGTGAAGCAGGGAGGG No data
1114867029_1114867037 24 Left 1114867029 14:26608384-26608406 CCATAATATGAAAGAAAGCTGCC No data
Right 1114867037 14:26608431-26608453 ACTAGTATGTGAAGCAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114867037 Original CRISPR ACTAGTATGTGAAGCAGGGA GGG Intergenic
No off target data available for this crispr