ID: 1114871791

View in Genome Browser
Species Human (GRCh38)
Location 14:26667155-26667177
Sequence TAGGAAGACCAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114871791_1114871796 8 Left 1114871791 14:26667155-26667177 CCTTCCTCCTTCTGGTCTTCCTA No data
Right 1114871796 14:26667186-26667208 AGTTGTTGCATACTCAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114871791 Original CRISPR TAGGAAGACCAGAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr