ID: 1114876193

View in Genome Browser
Species Human (GRCh38)
Location 14:26721674-26721696
Sequence TTGCTGTTCTGTAGGAATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114876190_1114876193 -7 Left 1114876190 14:26721658-26721680 CCATCAAATGAAGACCTTGCTGT No data
Right 1114876193 14:26721674-26721696 TTGCTGTTCTGTAGGAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114876193 Original CRISPR TTGCTGTTCTGTAGGAATAA AGG Intergenic
No off target data available for this crispr