ID: 1114876874

View in Genome Browser
Species Human (GRCh38)
Location 14:26731348-26731370
Sequence CCATTGCTAGACCACTGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114876874_1114876885 26 Left 1114876874 14:26731348-26731370 CCAGAGCAGTGGTCTAGCAATGG No data
Right 1114876885 14:26731397-26731419 ATGGAGGCCTAGTCTTAGGAGGG No data
1114876874_1114876883 22 Left 1114876874 14:26731348-26731370 CCAGAGCAGTGGTCTAGCAATGG No data
Right 1114876883 14:26731393-26731415 AAAAATGGAGGCCTAGTCTTAGG No data
1114876874_1114876881 7 Left 1114876874 14:26731348-26731370 CCAGAGCAGTGGTCTAGCAATGG No data
Right 1114876881 14:26731378-26731400 TTGAGGACAGCTGTGAAAAATGG No data
1114876874_1114876876 -10 Left 1114876874 14:26731348-26731370 CCAGAGCAGTGGTCTAGCAATGG No data
Right 1114876876 14:26731361-26731383 CTAGCAATGGCCCCCACTTGAGG No data
1114876874_1114876882 10 Left 1114876874 14:26731348-26731370 CCAGAGCAGTGGTCTAGCAATGG No data
Right 1114876882 14:26731381-26731403 AGGACAGCTGTGAAAAATGGAGG No data
1114876874_1114876884 25 Left 1114876874 14:26731348-26731370 CCAGAGCAGTGGTCTAGCAATGG No data
Right 1114876884 14:26731396-26731418 AATGGAGGCCTAGTCTTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114876874 Original CRISPR CCATTGCTAGACCACTGCTC TGG (reversed) Intergenic
No off target data available for this crispr