ID: 1114876877

View in Genome Browser
Species Human (GRCh38)
Location 14:26731371-26731393
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114876877_1114876891 30 Left 1114876877 14:26731371-26731393 CCCCCACTTGAGGACAGCTGTGA No data
Right 1114876891 14:26731424-26731446 CAGCAGTAATGGAGGCAGTGGGG No data
1114876877_1114876888 22 Left 1114876877 14:26731371-26731393 CCCCCACTTGAGGACAGCTGTGA No data
Right 1114876888 14:26731416-26731438 AGGGTCAGCAGCAGTAATGGAGG No data
1114876877_1114876887 19 Left 1114876877 14:26731371-26731393 CCCCCACTTGAGGACAGCTGTGA No data
Right 1114876887 14:26731413-26731435 AGGAGGGTCAGCAGCAGTAATGG No data
1114876877_1114876885 3 Left 1114876877 14:26731371-26731393 CCCCCACTTGAGGACAGCTGTGA No data
Right 1114876885 14:26731397-26731419 ATGGAGGCCTAGTCTTAGGAGGG No data
1114876877_1114876884 2 Left 1114876877 14:26731371-26731393 CCCCCACTTGAGGACAGCTGTGA No data
Right 1114876884 14:26731396-26731418 AATGGAGGCCTAGTCTTAGGAGG No data
1114876877_1114876883 -1 Left 1114876877 14:26731371-26731393 CCCCCACTTGAGGACAGCTGTGA No data
Right 1114876883 14:26731393-26731415 AAAAATGGAGGCCTAGTCTTAGG No data
1114876877_1114876889 28 Left 1114876877 14:26731371-26731393 CCCCCACTTGAGGACAGCTGTGA No data
Right 1114876889 14:26731422-26731444 AGCAGCAGTAATGGAGGCAGTGG No data
1114876877_1114876890 29 Left 1114876877 14:26731371-26731393 CCCCCACTTGAGGACAGCTGTGA No data
Right 1114876890 14:26731423-26731445 GCAGCAGTAATGGAGGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114876877 Original CRISPR TCACAGCTGTCCTCAAGTGG GGG (reversed) Intergenic
No off target data available for this crispr