ID: 1114876884

View in Genome Browser
Species Human (GRCh38)
Location 14:26731396-26731418
Sequence AATGGAGGCCTAGTCTTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114876878_1114876884 1 Left 1114876878 14:26731372-26731394 CCCCACTTGAGGACAGCTGTGAA No data
Right 1114876884 14:26731396-26731418 AATGGAGGCCTAGTCTTAGGAGG No data
1114876880_1114876884 -1 Left 1114876880 14:26731374-26731396 CCACTTGAGGACAGCTGTGAAAA No data
Right 1114876884 14:26731396-26731418 AATGGAGGCCTAGTCTTAGGAGG No data
1114876874_1114876884 25 Left 1114876874 14:26731348-26731370 CCAGAGCAGTGGTCTAGCAATGG No data
Right 1114876884 14:26731396-26731418 AATGGAGGCCTAGTCTTAGGAGG No data
1114876877_1114876884 2 Left 1114876877 14:26731371-26731393 CCCCCACTTGAGGACAGCTGTGA No data
Right 1114876884 14:26731396-26731418 AATGGAGGCCTAGTCTTAGGAGG No data
1114876879_1114876884 0 Left 1114876879 14:26731373-26731395 CCCACTTGAGGACAGCTGTGAAA No data
Right 1114876884 14:26731396-26731418 AATGGAGGCCTAGTCTTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114876884 Original CRISPR AATGGAGGCCTAGTCTTAGG AGG Intergenic
No off target data available for this crispr