ID: 1114876886

View in Genome Browser
Species Human (GRCh38)
Location 14:26731404-26731426
Sequence CTGCTGACCCTCCTAAGACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114876886_1114876891 -3 Left 1114876886 14:26731404-26731426 CCTAGTCTTAGGAGGGTCAGCAG No data
Right 1114876891 14:26731424-26731446 CAGCAGTAATGGAGGCAGTGGGG No data
1114876886_1114876893 8 Left 1114876886 14:26731404-26731426 CCTAGTCTTAGGAGGGTCAGCAG No data
Right 1114876893 14:26731435-26731457 GAGGCAGTGGGGCCACCTGGTGG No data
1114876886_1114876890 -4 Left 1114876886 14:26731404-26731426 CCTAGTCTTAGGAGGGTCAGCAG No data
Right 1114876890 14:26731423-26731445 GCAGCAGTAATGGAGGCAGTGGG No data
1114876886_1114876894 17 Left 1114876886 14:26731404-26731426 CCTAGTCTTAGGAGGGTCAGCAG No data
Right 1114876894 14:26731444-26731466 GGGCCACCTGGTGGAGACACTGG No data
1114876886_1114876892 5 Left 1114876886 14:26731404-26731426 CCTAGTCTTAGGAGGGTCAGCAG No data
Right 1114876892 14:26731432-26731454 ATGGAGGCAGTGGGGCCACCTGG No data
1114876886_1114876889 -5 Left 1114876886 14:26731404-26731426 CCTAGTCTTAGGAGGGTCAGCAG No data
Right 1114876889 14:26731422-26731444 AGCAGCAGTAATGGAGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114876886 Original CRISPR CTGCTGACCCTCCTAAGACT AGG (reversed) Intergenic
No off target data available for this crispr