ID: 1114876889

View in Genome Browser
Species Human (GRCh38)
Location 14:26731422-26731444
Sequence AGCAGCAGTAATGGAGGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114876880_1114876889 25 Left 1114876880 14:26731374-26731396 CCACTTGAGGACAGCTGTGAAAA No data
Right 1114876889 14:26731422-26731444 AGCAGCAGTAATGGAGGCAGTGG No data
1114876886_1114876889 -5 Left 1114876886 14:26731404-26731426 CCTAGTCTTAGGAGGGTCAGCAG No data
Right 1114876889 14:26731422-26731444 AGCAGCAGTAATGGAGGCAGTGG No data
1114876879_1114876889 26 Left 1114876879 14:26731373-26731395 CCCACTTGAGGACAGCTGTGAAA No data
Right 1114876889 14:26731422-26731444 AGCAGCAGTAATGGAGGCAGTGG No data
1114876878_1114876889 27 Left 1114876878 14:26731372-26731394 CCCCACTTGAGGACAGCTGTGAA No data
Right 1114876889 14:26731422-26731444 AGCAGCAGTAATGGAGGCAGTGG No data
1114876877_1114876889 28 Left 1114876877 14:26731371-26731393 CCCCCACTTGAGGACAGCTGTGA No data
Right 1114876889 14:26731422-26731444 AGCAGCAGTAATGGAGGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114876889 Original CRISPR AGCAGCAGTAATGGAGGCAG TGG Intergenic
No off target data available for this crispr