ID: 1114887160

View in Genome Browser
Species Human (GRCh38)
Location 14:26867582-26867604
Sequence CTGTGTTACATTGGCTAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114887158_1114887160 14 Left 1114887158 14:26867545-26867567 CCAAACTTCAGATACAGAAGGTC No data
Right 1114887160 14:26867582-26867604 CTGTGTTACATTGGCTAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114887160 Original CRISPR CTGTGTTACATTGGCTAGAT AGG Intergenic
No off target data available for this crispr