ID: 1114891314

View in Genome Browser
Species Human (GRCh38)
Location 14:26927188-26927210
Sequence CATGCTGCAGAAACTCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114891309_1114891314 4 Left 1114891309 14:26927161-26927183 CCATCAGTTACACATTATTACCT No data
Right 1114891314 14:26927188-26927210 CATGCTGCAGAAACTCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114891314 Original CRISPR CATGCTGCAGAAACTCAGGA GGG Intergenic
No off target data available for this crispr