ID: 1114891438

View in Genome Browser
Species Human (GRCh38)
Location 14:26929005-26929027
Sequence TCTAGCAACCAGAGTGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114891433_1114891438 29 Left 1114891433 14:26928953-26928975 CCTTCACCTGGGTGAATCTTTCA No data
Right 1114891438 14:26929005-26929027 TCTAGCAACCAGAGTGAGCTTGG No data
1114891434_1114891438 23 Left 1114891434 14:26928959-26928981 CCTGGGTGAATCTTTCATTACCT No data
Right 1114891438 14:26929005-26929027 TCTAGCAACCAGAGTGAGCTTGG No data
1114891435_1114891438 3 Left 1114891435 14:26928979-26929001 CCTCTGACTTGTAATACTAAGCC No data
Right 1114891438 14:26929005-26929027 TCTAGCAACCAGAGTGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114891438 Original CRISPR TCTAGCAACCAGAGTGAGCT TGG Intergenic
No off target data available for this crispr