ID: 1114892493

View in Genome Browser
Species Human (GRCh38)
Location 14:26942851-26942873
Sequence GCTGAAGCCATGACAGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114892493_1114892508 30 Left 1114892493 14:26942851-26942873 CCTTCTTCTGTCATGGCTTCAGC No data
Right 1114892508 14:26942904-26942926 CGCAACAGGCAGTGGAAGAAAGG No data
1114892493_1114892505 22 Left 1114892493 14:26942851-26942873 CCTTCTTCTGTCATGGCTTCAGC No data
Right 1114892505 14:26942896-26942918 TGACTTCCCGCAACAGGCAGTGG No data
1114892493_1114892502 16 Left 1114892493 14:26942851-26942873 CCTTCTTCTGTCATGGCTTCAGC No data
Right 1114892502 14:26942890-26942912 GGTCCCTGACTTCCCGCAACAGG 0: 36
1: 56
2: 27
3: 13
4: 90
1114892493_1114892495 -7 Left 1114892493 14:26942851-26942873 CCTTCTTCTGTCATGGCTTCAGC No data
Right 1114892495 14:26942867-26942889 CTTCAGCCGGTCCCTCCGTTTGG 0: 151
1: 390
2: 489
3: 325
4: 170
1114892493_1114892497 -5 Left 1114892493 14:26942851-26942873 CCTTCTTCTGTCATGGCTTCAGC No data
Right 1114892497 14:26942869-26942891 TCAGCCGGTCCCTCCGTTTGGGG 0: 114
1: 304
2: 397
3: 459
4: 385
1114892493_1114892496 -6 Left 1114892493 14:26942851-26942873 CCTTCTTCTGTCATGGCTTCAGC No data
Right 1114892496 14:26942868-26942890 TTCAGCCGGTCCCTCCGTTTGGG 0: 117
1: 326
2: 492
3: 536
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114892493 Original CRISPR GCTGAAGCCATGACAGAAGA AGG (reversed) Intergenic
No off target data available for this crispr