ID: 1114895218

View in Genome Browser
Species Human (GRCh38)
Location 14:26981245-26981267
Sequence ACTAGGACCTTGCTAATTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114895218_1114895224 23 Left 1114895218 14:26981245-26981267 CCTGTAATTAGCAAGGTCCTAGT No data
Right 1114895224 14:26981291-26981313 TTGATGCCTAACTCGAGTAGGGG No data
1114895218_1114895222 21 Left 1114895218 14:26981245-26981267 CCTGTAATTAGCAAGGTCCTAGT No data
Right 1114895222 14:26981289-26981311 ACTTGATGCCTAACTCGAGTAGG No data
1114895218_1114895223 22 Left 1114895218 14:26981245-26981267 CCTGTAATTAGCAAGGTCCTAGT No data
Right 1114895223 14:26981290-26981312 CTTGATGCCTAACTCGAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114895218 Original CRISPR ACTAGGACCTTGCTAATTAC AGG (reversed) Intergenic
No off target data available for this crispr