ID: 1114895860

View in Genome Browser
Species Human (GRCh38)
Location 14:26990577-26990599
Sequence GGGGAAAAATGCTTATTAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114895860_1114895869 14 Left 1114895860 14:26990577-26990599 CCTATTAATAAGCATTTTTCCCC No data
Right 1114895869 14:26990614-26990636 GACATAGAATAGGGAGAAGAAGG No data
1114895860_1114895870 18 Left 1114895860 14:26990577-26990599 CCTATTAATAAGCATTTTTCCCC No data
Right 1114895870 14:26990618-26990640 TAGAATAGGGAGAAGAAGGAAGG No data
1114895860_1114895867 5 Left 1114895860 14:26990577-26990599 CCTATTAATAAGCATTTTTCCCC No data
Right 1114895867 14:26990605-26990627 TACCAGGCAGACATAGAATAGGG No data
1114895860_1114895866 4 Left 1114895860 14:26990577-26990599 CCTATTAATAAGCATTTTTCCCC No data
Right 1114895866 14:26990604-26990626 ATACCAGGCAGACATAGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114895860 Original CRISPR GGGGAAAAATGCTTATTAAT AGG (reversed) Intergenic
No off target data available for this crispr