ID: 1114895862

View in Genome Browser
Species Human (GRCh38)
Location 14:26990596-26990618
Sequence ATGTCTGCCTGGTATCTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114895862_1114895870 -1 Left 1114895862 14:26990596-26990618 CCCCCAAGATACCAGGCAGACAT No data
Right 1114895870 14:26990618-26990640 TAGAATAGGGAGAAGAAGGAAGG No data
1114895862_1114895869 -5 Left 1114895862 14:26990596-26990618 CCCCCAAGATACCAGGCAGACAT No data
Right 1114895869 14:26990614-26990636 GACATAGAATAGGGAGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114895862 Original CRISPR ATGTCTGCCTGGTATCTTGG GGG (reversed) Intergenic
No off target data available for this crispr