ID: 1114895865 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:26990599-26990621 |
| Sequence | TCTATGTCTGCCTGGTATCT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1114895865_1114895870 | -4 | Left | 1114895865 | 14:26990599-26990621 | CCAAGATACCAGGCAGACATAGA | No data | ||
| Right | 1114895870 | 14:26990618-26990640 | TAGAATAGGGAGAAGAAGGAAGG | No data | ||||
| 1114895865_1114895869 | -8 | Left | 1114895865 | 14:26990599-26990621 | CCAAGATACCAGGCAGACATAGA | No data | ||
| Right | 1114895869 | 14:26990614-26990636 | GACATAGAATAGGGAGAAGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1114895865 | Original CRISPR | TCTATGTCTGCCTGGTATCT TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||