ID: 1114895870

View in Genome Browser
Species Human (GRCh38)
Location 14:26990618-26990640
Sequence TAGAATAGGGAGAAGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114895862_1114895870 -1 Left 1114895862 14:26990596-26990618 CCCCCAAGATACCAGGCAGACAT No data
Right 1114895870 14:26990618-26990640 TAGAATAGGGAGAAGAAGGAAGG No data
1114895864_1114895870 -3 Left 1114895864 14:26990598-26990620 CCCAAGATACCAGGCAGACATAG No data
Right 1114895870 14:26990618-26990640 TAGAATAGGGAGAAGAAGGAAGG No data
1114895860_1114895870 18 Left 1114895860 14:26990577-26990599 CCTATTAATAAGCATTTTTCCCC No data
Right 1114895870 14:26990618-26990640 TAGAATAGGGAGAAGAAGGAAGG No data
1114895863_1114895870 -2 Left 1114895863 14:26990597-26990619 CCCCAAGATACCAGGCAGACATA No data
Right 1114895870 14:26990618-26990640 TAGAATAGGGAGAAGAAGGAAGG No data
1114895865_1114895870 -4 Left 1114895865 14:26990599-26990621 CCAAGATACCAGGCAGACATAGA No data
Right 1114895870 14:26990618-26990640 TAGAATAGGGAGAAGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114895870 Original CRISPR TAGAATAGGGAGAAGAAGGA AGG Intergenic
No off target data available for this crispr