ID: 1114896662

View in Genome Browser
Species Human (GRCh38)
Location 14:26999260-26999282
Sequence ATTAGCACAATGATCGTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114896662_1114896663 4 Left 1114896662 14:26999260-26999282 CCTGTCACGATCATTGTGCTAAT No data
Right 1114896663 14:26999287-26999309 AAAGAGATGCCAGAATAAATTGG No data
1114896662_1114896664 5 Left 1114896662 14:26999260-26999282 CCTGTCACGATCATTGTGCTAAT No data
Right 1114896664 14:26999288-26999310 AAGAGATGCCAGAATAAATTGGG No data
1114896662_1114896666 29 Left 1114896662 14:26999260-26999282 CCTGTCACGATCATTGTGCTAAT No data
Right 1114896666 14:26999312-26999334 AAAATAATTTACCTTTGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114896662 Original CRISPR ATTAGCACAATGATCGTGAC AGG (reversed) Intergenic
No off target data available for this crispr