ID: 1114896664

View in Genome Browser
Species Human (GRCh38)
Location 14:26999288-26999310
Sequence AAGAGATGCCAGAATAAATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114896661_1114896664 11 Left 1114896661 14:26999254-26999276 CCAAAGCCTGTCACGATCATTGT No data
Right 1114896664 14:26999288-26999310 AAGAGATGCCAGAATAAATTGGG No data
1114896662_1114896664 5 Left 1114896662 14:26999260-26999282 CCTGTCACGATCATTGTGCTAAT No data
Right 1114896664 14:26999288-26999310 AAGAGATGCCAGAATAAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114896664 Original CRISPR AAGAGATGCCAGAATAAATT GGG Intergenic
No off target data available for this crispr