ID: 1114896666

View in Genome Browser
Species Human (GRCh38)
Location 14:26999312-26999334
Sequence AAAATAATTTACCTTTGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114896665_1114896666 -7 Left 1114896665 14:26999296-26999318 CCAGAATAAATTGGGAAAAATAA No data
Right 1114896666 14:26999312-26999334 AAAATAATTTACCTTTGTGATGG No data
1114896662_1114896666 29 Left 1114896662 14:26999260-26999282 CCTGTCACGATCATTGTGCTAAT No data
Right 1114896666 14:26999312-26999334 AAAATAATTTACCTTTGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114896666 Original CRISPR AAAATAATTTACCTTTGTGA TGG Intergenic
No off target data available for this crispr