ID: 1114897616

View in Genome Browser
Species Human (GRCh38)
Location 14:27010823-27010845
Sequence ATTCATTTGGGGCATGTGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114897610_1114897616 1 Left 1114897610 14:27010799-27010821 CCAACCCTTCTCTTTTGTGTCTG No data
Right 1114897616 14:27010823-27010845 ATTCATTTGGGGCATGTGATAGG No data
1114897611_1114897616 -3 Left 1114897611 14:27010803-27010825 CCCTTCTCTTTTGTGTCTGTATT No data
Right 1114897616 14:27010823-27010845 ATTCATTTGGGGCATGTGATAGG No data
1114897612_1114897616 -4 Left 1114897612 14:27010804-27010826 CCTTCTCTTTTGTGTCTGTATTC No data
Right 1114897616 14:27010823-27010845 ATTCATTTGGGGCATGTGATAGG No data
1114897609_1114897616 24 Left 1114897609 14:27010776-27010798 CCTTAAACAATGACTGATAGATT No data
Right 1114897616 14:27010823-27010845 ATTCATTTGGGGCATGTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114897616 Original CRISPR ATTCATTTGGGGCATGTGAT AGG Intergenic
No off target data available for this crispr