ID: 1114897715

View in Genome Browser
Species Human (GRCh38)
Location 14:27012275-27012297
Sequence TGGAAAGAATGACTGTCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114897715_1114897718 6 Left 1114897715 14:27012275-27012297 CCCAAGGACAGTCATTCTTTCCA No data
Right 1114897718 14:27012304-27012326 GAAAGTTGCGAAATGAATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114897715 Original CRISPR TGGAAAGAATGACTGTCCTT GGG (reversed) Intergenic
No off target data available for this crispr