ID: 1114898566

View in Genome Browser
Species Human (GRCh38)
Location 14:27026341-27026363
Sequence CAGCATTATATCAAGGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114898566_1114898569 12 Left 1114898566 14:27026341-27026363 CCTCTCTCCTTGATATAATGCTG No data
Right 1114898569 14:27026376-27026398 ATGATTGCTCAGCTAAGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114898566 Original CRISPR CAGCATTATATCAAGGAGAG AGG (reversed) Intergenic
No off target data available for this crispr