ID: 1114905072

View in Genome Browser
Species Human (GRCh38)
Location 14:27118027-27118049
Sequence GCAGTGCCAGAATATAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114905072_1114905073 -9 Left 1114905072 14:27118027-27118049 CCTGCTTTATATTCTGGCACTGC No data
Right 1114905073 14:27118041-27118063 TGGCACTGCTAGCAGCTGATTGG No data
1114905072_1114905075 13 Left 1114905072 14:27118027-27118049 CCTGCTTTATATTCTGGCACTGC No data
Right 1114905075 14:27118063-27118085 GATGGTGCCCACTCTGATTAAGG No data
1114905072_1114905074 -5 Left 1114905072 14:27118027-27118049 CCTGCTTTATATTCTGGCACTGC No data
Right 1114905074 14:27118045-27118067 ACTGCTAGCAGCTGATTGGATGG No data
1114905072_1114905076 14 Left 1114905072 14:27118027-27118049 CCTGCTTTATATTCTGGCACTGC No data
Right 1114905076 14:27118064-27118086 ATGGTGCCCACTCTGATTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114905072 Original CRISPR GCAGTGCCAGAATATAAAGC AGG (reversed) Intergenic
No off target data available for this crispr