ID: 1114905076

View in Genome Browser
Species Human (GRCh38)
Location 14:27118064-27118086
Sequence ATGGTGCCCACTCTGATTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114905072_1114905076 14 Left 1114905072 14:27118027-27118049 CCTGCTTTATATTCTGGCACTGC No data
Right 1114905076 14:27118064-27118086 ATGGTGCCCACTCTGATTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114905076 Original CRISPR ATGGTGCCCACTCTGATTAA GGG Intergenic
No off target data available for this crispr