ID: 1114905146

View in Genome Browser
Species Human (GRCh38)
Location 14:27118730-27118752
Sequence GCCCTGTGATTACGGTCAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114905146_1114905149 5 Left 1114905146 14:27118730-27118752 CCCATTGACCGTAATCACAGGGC No data
Right 1114905149 14:27118758-27118780 AATACTAAGAGACACCTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114905146 Original CRISPR GCCCTGTGATTACGGTCAAT GGG (reversed) Intergenic
No off target data available for this crispr