ID: 1114905378

View in Genome Browser
Species Human (GRCh38)
Location 14:27120449-27120471
Sequence TGCTATCTGAAGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114905374_1114905378 22 Left 1114905374 14:27120404-27120426 CCAAAGACAAGTAACAGGCCAAT No data
Right 1114905378 14:27120449-27120471 TGCTATCTGAAGAAGATGGCAGG No data
1114905376_1114905378 4 Left 1114905376 14:27120422-27120444 CCAATAGCTGTCTCTCATAAGGA No data
Right 1114905378 14:27120449-27120471 TGCTATCTGAAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114905378 Original CRISPR TGCTATCTGAAGAAGATGGC AGG Intergenic
No off target data available for this crispr