ID: 1114906162

View in Genome Browser
Species Human (GRCh38)
Location 14:27129466-27129488
Sequence GTAAATTGCTTGGGTAAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114906162_1114906166 -2 Left 1114906162 14:27129466-27129488 CCTATTTTACCCAAGCAATTTAC No data
Right 1114906166 14:27129487-27129509 ACACTTGCAAAGTGGTAAAGAGG No data
1114906162_1114906165 -10 Left 1114906162 14:27129466-27129488 CCTATTTTACCCAAGCAATTTAC No data
Right 1114906165 14:27129479-27129501 AGCAATTTACACTTGCAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114906162 Original CRISPR GTAAATTGCTTGGGTAAAAT AGG (reversed) Intergenic
No off target data available for this crispr