ID: 1114907151

View in Genome Browser
Species Human (GRCh38)
Location 14:27144246-27144268
Sequence CAAGCTGGTCGCTCTGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114907151_1114907156 16 Left 1114907151 14:27144246-27144268 CCCATATCAGAGCGACCAGCTTG No data
Right 1114907156 14:27144285-27144307 CATTGATACCCGCCTCAGGCAGG No data
1114907151_1114907155 12 Left 1114907151 14:27144246-27144268 CCCATATCAGAGCGACCAGCTTG No data
Right 1114907155 14:27144281-27144303 ACATCATTGATACCCGCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114907151 Original CRISPR CAAGCTGGTCGCTCTGATAT GGG (reversed) Intergenic
No off target data available for this crispr