ID: 1114909972

View in Genome Browser
Species Human (GRCh38)
Location 14:27179670-27179692
Sequence GGAACATGGTATAGTGCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114909972_1114909974 -10 Left 1114909972 14:27179670-27179692 CCAATGGCACTATACCATGTTCC No data
Right 1114909974 14:27179683-27179705 ACCATGTTCCATAGGTGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114909972 Original CRISPR GGAACATGGTATAGTGCCAT TGG (reversed) Intergenic
No off target data available for this crispr