ID: 1114912219

View in Genome Browser
Species Human (GRCh38)
Location 14:27214563-27214585
Sequence ATGCTCTTCTAAAAGAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1114912218_1114912219 2 Left 1114912218 14:27214538-27214560 CCATGGAAAAAGGACTTGACAAA No data
Right 1114912219 14:27214563-27214585 ATGCTCTTCTAAAAGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1114912219 Original CRISPR ATGCTCTTCTAAAAGAGTGA AGG Intergenic
No off target data available for this crispr